Modificar 'validation/validation_conf_12052023.py'

.gitignore

@@ -1,3 +0,0 @@
-mirri/biolomics/secrets.py
-.vscode/launch.json
-*.pyc

README.md

@@ -1,34 +0,0 @@
-# MIRRI Utils
-
-## Installation
-
-> pip install path_to_package.tar.gz
-
-
-## Description
-
-A small set of utilities to deal with Mirri Data.
-
- -  A data class to deal with strain data.
-
- - An excel reader for mirri specification
-
- - An excel validator for mirri specification
-
- - An excel writer to create the excel with MIRRI specifications
-
-
-## Update 06-09-2022
-Under the bin directory:
-bin\
- upload_strains_to_mirri_is_NEWDB.py
- validateNEW.py
-
-those files are created to inserting the data from the excel files into the database mirridb.
-
-validateNEW.py:
->the purpose of this file is to be the orchestator for the validations and the calling the upload to mirridb.
-
-
-upload_strains_to_mirri_is_NEWDB.py:
-This script is inserting the excel into the database, the code has comments regarding the steps.

bin/delete_duplicated_strain_by_number.py

@@ -1,77 +0,0 @@
-#!/usr/bin/env python3
-import argparse
-import sys
-
-from mirri.biolomics.remote.biolomics_client import BiolomicsMirriClient
-from mirri.biolomics.remote.endoint_names import GROWTH_MEDIUM_WS, STRAIN_WS
-
-SERVER_URL = 'https://webservices.bio-aware.com/mirri_test'
-
-
-def get_cmd_args():
-    desc = "Upload strains to MIRRI-IS"
-    parser = argparse.ArgumentParser(description=desc)
-    parser.add_argument('-a', '--accession_number', required=True,
-                        help='Delete the duplicated items in database for the given accession number')
-    parser.add_argument('-u', '--ws_user', help='Username of the web service',
-                        required=True)
-    parser.add_argument('-p', '--ws_password', required=True,
-                        help='Password of the web service user')
-    parser.add_argument('-c', '--client_id', required=True,
-                        help='Client id of the web service')
-    parser.add_argument('-s', '--client_secret', required=True,
-                        help='Client secret of the web service')
-
-    args = parser.parse_args()
-
-    return {'accession_number': args.accession_number, 'user': args.ws_user,
-            'password': args.ws_password, 'client_id': args.client_id,
-            'client_secret': args.client_secret}
-
-
-def write_errors_in_screen(errors, fhand=sys.stderr):
-    for key, errors_by_type in errors.items():
-        fhand.write(f'{key}\n')
-        fhand.write('-' * len(key) + '\n')
-        for error in errors_by_type:
-            if error.pk:
-                fhand.write(f'{error.pk}: ')
-            fhand.write(f'{error.message} - {error.code}\n')
-        fhand.write('\n')
-
-
-def main():
-    args = get_cmd_args()
-    out_fhand = sys.stdout
-
-    client = BiolomicsMirriClient(server_url=SERVER_URL,  api_version= 'v2',
-                                  client_id=args['client_id'],
-                                  client_secret=args['client_secret'],
-                                  username=args['user'],
-                                  password=args['password'])
-    query = {"Query": [{"Index": 0,
-                        "FieldName": "Collection accession number",
-                        "Operation": "TextExactMatch",
-                        "Value": args['accession_number']}],
-             "Expression": "Q0",
-             "DisplayStart": 0,
-             "DisplayLength": 10}
-
-    result = client.search(STRAIN_WS, query=query)
-    total = result["total"]
-    if total == 0:
-        out_fhand.write('Accession not in database\n')
-        sys.exit(0)
-        return None
-    elif total == 1:
-        out_fhand.write('Accession is not duplicated\n')
-        sys.exit(0)
-
-    print(f'Duplicates found: {total}. removing duplicates')
-    duplicated_ids = [record.record_id  for record in result['records']]
-    for duplicated_id in duplicated_ids[:-1]:
-        client.delete_by_id(STRAIN_WS, duplicated_id)
-
-
-if __name__ == '__main__':
-    main()

bin/delete_mirri_data.py

@@ -1,91 +0,0 @@
-#!/usr/bin/env python3
-import argparse
-import sys
-
-from mirri.biolomics.pipelines.strain import retrieve_strain_by_accession_number
-from mirri.biolomics.remote.biolomics_client import BiolomicsMirriClient
-from mirri.biolomics.remote.endoint_names import GROWTH_MEDIUM_WS, STRAIN_WS
-from mirri.io.parsers.mirri_excel import parse_mirri_excel
-from mirri.validation.excel_validator import validate_mirri_excel
-
-SERVER_URL = 'https://webservices.bio-aware.com/mirri_test'
-
-
-def get_cmd_args():
-    desc = "Upload strains to MIRRI-IS"
-    parser = argparse.ArgumentParser(description=desc)
-    parser.add_argument('-i', '--input', help='Validated Excel file',
-                        type=argparse.FileType('rb'), required=True)
-    parser.add_argument('-v', '--spec_version', default='20200601',
-                        help='Version of he specification of the given excel file')
-    parser.add_argument('-u', '--ws_user', help='Username of the web service',
-                        required=True)
-    parser.add_argument('-p', '--ws_password', required=True,
-                        help='Password of the web service user')
-    parser.add_argument('-c', '--client_id', required=True,
-                        help='Client id of the web service')
-    parser.add_argument('-s', '--client_secret', required=True,
-                        help='Client secret of the web service')
-    parser.add_argument('-f', '--force_update', required=False,
-                        action='store_true',
-                        help='Use it if you want to update the existing strains')
-
-    args = parser.parse_args()
-
-    return {'input_fhand': args.input, 'user': args.ws_user,
-            'version': args.spec_version,
-            'password': args.ws_password, 'client_id': args.client_id,
-            'client_secret': args.client_secret, 'update': args.force_update}
-
-
-def write_errors_in_screen(errors, fhand=sys.stderr):
-    for key, errors_by_type in errors.items():
-        fhand.write(f'{key}\n')
-        fhand.write('-' * len(key) + '\n')
-        for error in errors_by_type:
-            if error.pk:
-                fhand.write(f'{error.pk}: ')
-            fhand.write(f'{error.message} - {error.code}\n')
-        fhand.write('\n')
-
-
-def main():
-    args = get_cmd_args()
-    input_fhand = args['input_fhand']
-    spec_version = args['version']
-    out_fhand = sys.stderr
-    error_log = validate_mirri_excel(input_fhand, version=spec_version)
-    errors = error_log.get_errors()
-    if errors:
-        write_errors_in_screen(errors, out_fhand)
-        sys.exit(1)
-
-    input_fhand.seek(0)
-    parsed_objects = parse_mirri_excel(input_fhand, version=spec_version)
-    strains = list(parsed_objects['strains'])
-    growth_media = list(parsed_objects['growth_media'])
-
-    client = BiolomicsMirriClient(server_url=SERVER_URL,  api_version= 'v2',
-                                  client_id=args['client_id'],
-                                  client_secret=args['client_secret'],
-                                  username=args['user'],
-                                  password=args['password'])
-    for gm in growth_media:
-        try:
-            client.delete_by_name(GROWTH_MEDIUM_WS, gm.acronym)
-        except ValueError as error:
-            print(error)
-            continue
-        print(f'Growth medium {gm.acronym} deleted')
-
-    for strain in strains:
-        ws_strain = retrieve_strain_by_accession_number(client, strain.id.strain_id)
-        if ws_strain is not None:
-            client.delete_by_id(STRAIN_WS, ws_strain.record_id)
-            print(f'Strain {strain.id.strain_id} deleted')
-        else:
-            print(f'Strain {strain.id.strain_id} not in database')
-
-
-if __name__ == '__main__':
-    main()

bin/upload_strains_to_mirri_is.py

@@ -1,182 +0,0 @@
-#!/usr/bin/env python3
-import argparse
-import sys
-from collections import Counter
-
-from mirri.biolomics.pipelines.growth_medium import get_or_create_or_update_growth_medium
-from mirri.biolomics.pipelines.strain import get_or_create_or_update_strain
-from mirri.biolomics.remote.biolomics_client import BiolomicsMirriClient
-from mirri.io.parsers.mirri_excel import parse_mirri_excel
-from mirri.validation.excel_validator import validate_mirri_excel
-
-TEST_SERVER_URL = 'https://webservices.bio-aware.com/mirri_test'
-PROD_SERVER_URL = 'https://webservices.bio-aware.com/mirri'
-
-
-def get_cmd_args():
-    desc = "Upload strains to MIRRI-IS"
-    parser = argparse.ArgumentParser(description=desc)
-    parser.add_argument('-i', '--input', help='Validated Excel file',
-                        type=argparse.FileType('rb'), required=True)
-    parser.add_argument('-v', '--spec_version', default='20200601',
-                        help='Version of he specification of the given excel file')
-    parser.add_argument('-u', '--ws_user', help='Username of the web service',
-                        required=True)
-    parser.add_argument('-p', '--ws_password', required=True,
-                        help='Password of the web service user')
-    parser.add_argument('-c', '--client_id', required=True,
-                        help='Client id of the web service')
-    parser.add_argument('-s', '--client_secret', required=True,
-                        help='Client secret of the web service')
-    parser.add_argument('--force_update', required=False,
-                        action='store_true',
-                        help='Use it if you want to update the existing strains')
-    parser.add_argument('--verbose', action='store_true',
-                        help='use it if you want a verbose output')
-    parser.add_argument('--prod', action='store_true',
-                        help='Use production server')
-    parser.add_argument('--dont_add_gm', action='store_false',
-                        help="Don't add growth media", default=True)
-    parser.add_argument('--dont_add_strains', action='store_false',
-                        help="Don't add growth media", default=True)
-    parser.add_argument('--skip_first_num', type=int,
-                       help='skip first X strains to the tool')
-
-    args = parser.parse_args()
-
-    return {'input_fhand': args.input, 'user': args.ws_user,
-            'version': args.spec_version,
-            'password': args.ws_password, 'client_id': args.client_id,
-            'client_secret': args.client_secret, 'update': args.force_update,
-            'verbose': args.verbose, 'use_production_server': args.prod,
-            'add_gm': args.dont_add_gm, 'add_strains': args.dont_add_strains,
-            'skip_first_num': args.skip_first_num}
-
-
-def write_errors_in_screen(errors, fhand=sys.stderr):
-    for key, errors_by_type in errors.items():
-        fhand.write(f'{key}\n')
-        fhand.write('-' * len(key) + '\n')
-        for error in errors_by_type:
-            if error.pk:
-                fhand.write(f'{error.pk}: ')
-            fhand.write(f'{error.message} - {error.code}\n')
-        fhand.write('\n')
-
-
-def create_or_upload_strains(client, strains, update=False, counter=None,
-                             out_fhand=None, seek=None):
-    for index, strain in enumerate(strains):
-        if seek is not None and index < seek:
-            continue
-        # if strain.id.strain_id != 'CECT 5766':
-        #     continue
-        result = get_or_create_or_update_strain(client, strain, update=update)
-
-        new_strain = result['record']
-        created = result['created']
-        updated = result.get('updated', False)
-        if updated:
-            result_state = 'updated'
-        elif created:
-            result_state = 'created'
-        else:
-            result_state = 'not modified'
-        if counter is not None:
-            counter[result_state] += 1
-        if out_fhand is not None:
-            out_fhand.write(f'{index}: Strain {new_strain.id.strain_id}: {result_state}\n')
-        # break
-
-
-def create_or_upload_growth_media(client, growth_media, update=False, counter=None,
-                                  out_fhand=None):
-
-    for gm in growth_media:
-        result = get_or_create_or_update_growth_medium(client, gm, update)
-
-        new_gm = result['record']
-        created = result['created']
-        updated = result.get('updated', False)
-        if updated:
-            result_state = 'updated'
-        elif created:
-            result_state = 'created'
-        else:
-            result_state = 'not modified'
-        if counter is not None:
-            counter[result_state] += 1
-        if out_fhand is not None:
-            out_fhand.write(f'Growth medium {new_gm.record_name}: {result_state}\n')
-
-
-def main():
-    args = get_cmd_args()
-    input_fhand = args['input_fhand']
-    spec_version = args['version']
-    out_fhand = sys.stdout
-    error_log = validate_mirri_excel(input_fhand, version=spec_version)
-    errors = error_log.get_errors()
-    skip_first_num = args['skip_first_num']
-    if errors:
-        write_errors_in_screen(errors, out_fhand)
-        sys.exit(1)
-
-    input_fhand.seek(0)
-    parsed_objects = parse_mirri_excel(input_fhand, version=spec_version)
-    strains = list(parsed_objects['strains'])
-    growth_media = list(parsed_objects['growth_media'])
-
-    server_url = PROD_SERVER_URL if args['use_production_server'] else TEST_SERVER_URL
-
-    client = BiolomicsMirriClient(server_url=server_url,  api_version='v2',
-                                  client_id=args['client_id'],
-                                  client_secret=args['client_secret'],
-                                  username=args['user'],
-                                  password=args['password'],
-                                  verbose=args['verbose'])
-
-    if args['add_gm']:
-        client.start_transaction()
-        counter = Counter()
-        try:
-            create_or_upload_growth_media(client, growth_media, update=args['update'],
-                                          counter=counter, out_fhand=out_fhand)
-        except (Exception, KeyboardInterrupt) as error:
-            out_fhand.write('There were some errors in the Growth media upload\n')
-            out_fhand.write(str(error) + '\n')
-            out_fhand.write('Rolling back\n')
-            client.rollback()
-            raise
-        client.finish_transaction()
-        show_stats(counter, 'Growth Media', out_fhand)
-
-    if args['add_strains']:
-        client.start_transaction()
-        counter = Counter()
-        try:
-            create_or_upload_strains(client, strains, update=args['update'],
-                                     counter=counter,
-                                     out_fhand=out_fhand, seek=skip_first_num)
-            client.finish_transaction()
-        except (Exception, KeyboardInterrupt) as error:
-            out_fhand.write('There were some errors in the Strain upload\n')
-            out_fhand.write(str(error) + '\n')
-            out_fhand.write('rolling back\n')
-            # client.rollback()
-            raise
-        client.finish_transaction()
-        show_stats(counter, 'Strains', out_fhand)
-
-
-def show_stats(counter, kind, out_fhand):
-    out_fhand.write(f'{kind}\n')
-    line = ''.join(['-'] * len(kind))
-    out_fhand.write(f"{line}\n")
-    for kind2, value in counter.most_common(5):
-        out_fhand.write(f'{kind2}: {value}\n')
-    out_fhand.write('\n')
-
-
-if __name__ == '__main__':
-    main()

bin/upload_strains_to_mirri_is_NEWDB.py

@@ -1,224 +0,0 @@
-#!/usr/bin/env python3
-import argparse
-from cmath import nan
-import sys
-from collections import Counter
-
-#
-from mirri.biolomics.pipelines.growth_medium import get_or_create_or_update_growth_medium
-from mirri.biolomics.pipelines.strain import get_or_create_or_update_strain
-from mirri.biolomics.remote.biolomics_client import BiolomicsMirriClient
-from mirri.io.parsers.mirri_excel import parse_mirri_excel
-from mirri.validation.excel_validator import validate_mirri_excel
-
-##Database
-from sqlalchemy import create_engine, MetaData
-import pymysql
-import pandas as pd
-from pathlib import Path
-import numpy as np
-
-# DEFINE THE DATABASE CREDENTIALS
-user = 'mirridev'
-password = 'estramboticandolotodo'
-host = 'mirri-is.mirri.org'
-port = 33066
-database = 'mirri-db'
-
-TEST_SERVER_URL = 'https://webservices.bio-aware.com/mirri_test'
-PROD_SERVER_URL = 'https://webservices.bio-aware.com/mirri'
-
-def show_stats(counter, kind, out_fhand):
-    out_fhand.write(f'{kind}\n')
-    line = ''.join(['-'] * len(kind))
-    out_fhand.write(f"{line}\n")
-    for kind2, value in counter.most_common(5):
-        out_fhand.write(f'{kind2}: {value}\n')
-    out_fhand.write('\n')
-
-
-def get_cmd_args():
-    desc = "Upload strains to MIRRI-IS"
-    parser = argparse.ArgumentParser(description=desc)
-    parser.add_argument('-i'                , '--input', required=True, help='Validated Excel file', type=argparse.FileType('rb'))
-    parser.add_argument('-v'                , '--spec_version', default='20200601', help='Version of he specification of the given excel file')
-    parser.add_argument('-u'                , '--ws_user', help='Username of the web service')
-    parser.add_argument('-p'                , '--ws_password', required=True, help='Password of the web service user')
-    parser.add_argument('-c'                , '--client_id', required=True, help='Client id of the web service')
-    parser.add_argument('-s'                , '--client_secret', required=True, help='Client secret of the web service')
-    parser.add_argument('--force_update'    , required=False, action='store_true', help='Use it if you want to update the existing strains')
-    parser.add_argument('--verbose'         , action='store_true', help='use it if you want a verbose output')
-    parser.add_argument('--prod'            , action='store_true', help='Use production server')
-    parser.add_argument('--dont_add_gm'     , default=True, action='store_false', help="Don't add growth media")
-    parser.add_argument('--dont_add_strains', default=True, action='store_false', help="Don't add growth media")
-    parser.add_argument('--skip_first_num'  , type=int, help='skip first X strains to the tool')
-
-    args = parser.parse_args()
-
-    return {'input_fhand': args.input
-            ,'user': args.ws_user
-            ,'version': args.spec_version
-            ,'password': args.ws_password
-            ,'client_id': args.client_id
-            ,'client_secret': args.client_secret
-            ,'update': args.force_update
-            ,'verbose': args.verbose
-            ,'use_production_server': args.prod
-            ,'add_gm': args.dont_add_gm
-            ,'add_strains': args.dont_add_strains
-            ,'skip_first_num': args.skip_first_num
-        }
-
-
-def write_errors_in_screen(errors, fhand=sys.stderr):
-    for key, errors_by_type in errors.items():
-        fhand.write(f'{key}\n')
-        fhand.write('-' * len(key) + '\n')
-        for error in errors_by_type:
-            if error.pk:
-                fhand.write(f'{error.pk}: ')
-            fhand.write(f'{error.message} - {error.code}\n')
-        fhand.write('\n')
-
-
-def create_or_upload_strains(client, strains, update=False, counter=None, out_fhand=None, seek=None):
-
-    for index, strain in enumerate(strains):
-        if seek is not None and index < seek:
-            continue
-        # if strain.id.strain_id != 'CECT 5766':
-        #     continue
-        result = get_or_create_or_update_strain(client, strain, update=update)
-
-        new_strain = result['record']
-        created = result['created']
-        updated = result.get('updated', False)
-        if updated:
-            result_state = 'updated'
-        elif created:
-            result_state = 'created'
-        else:
-            result_state = 'not modified'
-
-        if counter is not None:
-            counter[result_state] += 1
-        if out_fhand is not None:
-            out_fhand.write(f'{index}: Strain {new_strain.id.strain_id}: {result_state}\n')
-        # break
-
-
-def create_or_upload_growth_media(client, growth_media, update=False, counter=None, out_fhand=None):
-
-    for gm in growth_media:
-        result = get_or_create_or_update_growth_medium(client, gm, update)
-
-        new_gm = result['record']
-        created = result['created']
-        updated = result.get('updated', False)
-        if updated:
-            result_state = 'updated'
-        elif created:
-            result_state = 'created'
-        else:
-            result_state = 'not modified'
-        if counter is not None:
-            counter[result_state] += 1
-        if out_fhand is not None:
-            out_fhand.write(f'Growth medium {new_gm.record_name}: {result_state}\n')
-
-  
-def get_connection():
-    # PYTHON FUNCTION TO CONNECT TO THE MYSQL DATABASE AND
-    # RETURN THE SQLACHEMY ENGINE OBJECT
-    return create_engine(url="mysql+pymysql://{0}:{1}@{2}:{3}/{4}".format(user, password, host, port, database))
-  
-def main():
-    ## Load Excel
-    path = Path('C://data//brclims_excel.xlsx')
-    Excel_Data = pd.read_excel(path, sheet_name = None)
-    cc_id=1
-
-    ## Load Database
-    sqlEngine  = get_connection()
-    engine     = sqlEngine.connect()
-
-    ## Create new file upload
-    with engine.connect() as conn:
-        metaDats = MetaData(conn, schema=database)
-        metaDats.reflect(bind=conn)
-        table = metaDats.tables['mirri-db.file_upload']
-        stmt = table.insert().values(filename=path.name,cc_id=cc_id)
-        aux=conn.execute(stmt).inserted_primary_key[0]
-
-        ## Load all Sheet from Excel to DB
-        for key in Excel_Data.keys():
-            #print(key)
-            n=Excel_Data[key].replace(np.nan, '', regex=True).astype(str)
-            n.columns = n.columns.str.replace(' ','_')
-            n['f_id']=aux
-            n.to_sql(key, engine, index=False, if_exists='append')
-
-    
-
-
-"""    
-    args = get_cmd_args()
-    input_fhand = args['input_fhand']
-    spec_version = args['version']
-    out_fhand = sys.stdout
-    error_log = validate_mirri_excel(input_fhand, version=spec_version)
-    errors = error_log.get_errors()
-    skip_first_num = args['skip_first_num']
-    if errors:
-        write_errors_in_screen(errors, out_fhand)
-        sys.exit(1)
-
-    input_fhand.seek(0)
-    parsed_objects = parse_mirri_excel(input_fhand, version=spec_version)
-    strains = list(parsed_objects['strains'])
-    growth_media = list(parsed_objects['growth_media'])
-
-    server_url = PROD_SERVER_URL if args['use_production_server'] else TEST_SERVER_URL
-
-    client = BiolomicsMirriClient(server_url=server_url,  api_version='v2',
-                                  client_id=args['client_id'],
-                                  client_secret=args['client_secret'],
-                                  username=args['user'],
-                                  password=args['password'],
-                                  verbose=args['verbose'])
-
-    if args['add_gm']:
-        client.start_transaction()
-        counter = Counter()
-        try:
-            create_or_upload_growth_media(client, growth_media, update=args['update'],
-                                          counter=counter, out_fhand=out_fhand)
-        except (Exception, KeyboardInterrupt) as error:
-            out_fhand.write('There were some errors in the Growth media upload\n')
-            out_fhand.write(str(error) + '\n')
-            out_fhand.write('Rolling back\n')
-            client.rollback()
-            raise
-        client.finish_transaction()
-        show_stats(counter, 'Growth Media', out_fhand)
-
-    if args['add_strains']:
-        client.start_transaction()
-        counter = Counter()
-        try:
-            create_or_upload_strains(client, strains, update=args['update'],
-                                     counter=counter,
-                                     out_fhand=out_fhand, seek=skip_first_num)
-            client.finish_transaction()
-        except (Exception, KeyboardInterrupt) as error:
-            out_fhand.write('There were some errors in the Strain upload\n')
-            out_fhand.write(str(error) + '\n')
-            out_fhand.write('rolling back\n')
-            # client.rollback()
-            raise
-        client.finish_transaction()
-        show_stats(counter, 'Strains', out_fhand)
-"""
-
-if __name__ == '__main__':
-    main()

bin/validateNEW.py

@@ -1,21 +0,0 @@
-#!/usr/bin/env python
-import sys
-from pathlib import Path
-from mirri.validation.excel_validator import validate_mirri_excel
-import warnings
-warnings.simplefilter("ignore")
-
-
-def main():
-    # path = Path(sys.argv[1])
-    path = Path( 'C:/data/brclims_excel.xlsx')
-    
-    error_log = validate_mirri_excel(path.open("rb"))
-
-    for errors in error_log.get_errors().values():
-        for error in errors:
-            print(error.pk, error.message, error.code)
-
-
-if __name__ == "__main__":
-    main()

io/parsers/mirri_excel.py

@@ -37,14 +37,14 @@ TRUEFALSE_TRANSLATOR = {
 }
 
 
-def parse_mirri_excel(fhand, version="20200601"):
-    if version == "20200601":
-        return _parse_mirri_v20200601(fhand)
+def parse_mirri_excel(fhand, version=""):
+    if version == "5.1.2":
+        return _parse_mirri_v12052023(fhand)            
     else:
-        raise NotImplementedError("Only version 20200601 is implemented")
+        raise NotImplementedError("Only version is 5.1.2 implemented")
 
 
-def _parse_mirri_v20200601(fhand):
+def _parse_mirri_v12052023(fhand):
     fhand.seek(0)
     file_content = BytesIO(fhand.read())
     wb = load_workbook(filename=file_content, read_only=True, data_only=True)
@@ -64,7 +64,6 @@ def _parse_mirri_v20200601(fhand):
 
     return {"strains": strains, "growth_media": growth_media}
 
-
 def index_list_by(list_, id_):
     return {str(item[id_]): item for item in list_}
 
@@ -125,7 +124,7 @@ def parse_strains(wb, locations, growth_media, markers, publications,
     publications = index_list_by_attr(publications, 'id')
     markers = index_markers(markers)
 
-    for strain_row in workbook_sheet_reader(wb, STRAINS, "Accession number"):
+    for strain_row in workbook_sheet_reader(wb, STRAINS, "accessionNumber"):
         strain = StrainMirri()
         strain_id = None
         label = None
@@ -202,8 +201,18 @@ def parse_strains(wb, locations, growth_media, markers, publications,
                 items = value.split(";")
                 strain.collect.location.latitude = float(items[0])
                 strain.collect.location.longitude = float(items[1])
+                strain.collect.location.precision = float(items[2])
+                strain.collect.location.altitude = float(items[3])
+                if len(items) > 4:
+                    strain.collect.location.coord_uncertainty = items[4]
+                    
+            elif attribute == "collect.site.links":
+                items = value.split(";")
+                strain.collect.site.links.nameSite = str(items[0])
+                strain.collect.site.links.urlSite = str(items[1])
+                rsetattr(strain, attribute, value.split(";")) #ver o separador
                 if len(items) > 2:
-                    strain.collect.location.coord_uncertainty = items[2]
+                    strain.collect.site.links.site_uncertainty = items[2]
                         
             elif attribute == "collect.location":
                 location = locations[value]

io/writers/mirri_excel.py

@@ -50,11 +50,10 @@ PUB_HEADERS = [pb["label"] for pb in PUBLICATION_FIELDS]
 
 
 def write_mirri_excel(path, strains, growth_media, version):
-    if version == "20200601":
-        _write_mirri_excel_20200601(path, strains, growth_media)
+    if version == "5.1.2":
+        _write_mirri_excel_12052023(path, strains, growth_media)
 
-
-def _write_mirri_excel_20200601(path, strains, growth_media):
+def _write_mirri_excel_12052023(path, strains, growth_media):
     wb = Workbook()
 
     write_markers_sheet(wb)
@@ -104,7 +103,7 @@ def _write_mirri_excel_20200601(path, strains, growth_media):
     redimension_cell_width(pub_sheet)
 
     # write sexual states
-    sex_sheet = wb.create_sheet("Sexual states")
+    sex_sheet = wb.create_sheet("Sexual state")
     for sex_state in sorted(list(sexual_states)):
         sex_sheet.append([sex_state])
     redimension_cell_width(sex_sheet)
@@ -121,7 +120,6 @@ def _write_mirri_excel_20200601(path, strains, growth_media):
     del wb["Sheet"]
     wb.save(str(path))
 
-
 def _deserialize_strains(strains, locations, growth_media_indexes,
                          publications, sexual_states, genomic_markers):
     for strain in strains:
@@ -189,8 +187,19 @@ def _deserialize_strains(strains, locations, growth_media_indexes,
             elif attribute == "collect.location.coords":
                 lat = strain.collect.location.latitude
                 long = strain.collect.location.longitude
-                if lat is not None and long is not None:
-                    value = f"{lat};{long}"
+                alt = strain.collect.location.altitude 
+                prec = strain.collect.location.precision
+                if lat is not None and long is not None and prec is not None and alt is not None:
+                    value = f"{lat};{long};{prec};{alt}"
+                else:
+                    value = None     
+            elif attribute == "collect.site.links":
+                name = strain.collect.site.links.nameSite
+                url = strain.collect.site.links.urlSite
+                value = rgetattr(strain, attribute)
+                value = ";".join(value)
+                if name is not None and url is not None:
+                    value = f"{name};{url}"
                 else:
                     value = None        
 

mirri/validation/entity_validators.py

@@ -1,50 +0,0 @@
-from mirri import rgetattr
-
-
-def validate_strain(strain, version='20200601'):
-    if version == '20200601':
-        return _validate_strain_v20200601(strain)
-    raise NotImplementedError('Only v20200601 is implemented')
-
-
-def _validate_strain_v20200601(strain):
-    mandatory_attrs = [{'label': 'Accession Number', 'attr': 'id.strain_id'},
-                       {'label': 'Nagoya protocol', 'attr': 'nagoya_protocol'},
-                       {'label': 'Restriction on use', 'attr': 'restriction_on_use'},
-                       {'label': 'Risk group', 'attr': 'risk_group'},
-                       {'label': 'Organism type', 'attr': 'taxonomy.organism_type'},
-                       {'label': 'Taxon name', 'attr': 'taxonomy.long_name'},
-                       {'label': 'Recommended temperature to growth', 'attr': 'growth.recommended_temp'},
-                       {'label': 'Recommended media', 'attr': 'growth.recommended_media'},
-                       {'label': 'Form of supply', 'attr': 'form_of_supply'},
-                       {'label': 'Country', 'attr': 'collect.location.country'}]
-
-    errors = []
-
-    for mandatory in mandatory_attrs:
-        value = rgetattr(strain, mandatory['attr'])
-        if value is None:
-            errors.append(f"{mandatory['label']} is mandatory field")
-
-    if not is_valid_nagoya(strain):
-        errors.append('Not compliant wih nagoya protocol requirements')
-
-    return errors
-
-
-def is_valid_nagoya(strain):
-    # nagoya_requirements
-    _date = strain.collect.date
-    if _date is None:
-        _date = strain.isolation.date
-    if _date is None:
-        _date = strain.deposit.date
-    if _date is None:
-        _date = strain.catalog_inclusion_date
-    # print(_date)
-    year = None if _date is None else _date._year
-
-    if year is not None and year >= 2014 and strain.collect.location.country is None:
-        return False
-
-    return True

mirri/validation/error_logging/error_message.py

@@ -1,414 +0,0 @@
-from typing import Optional
-
-
-class ErrorMessage():
-    """Error message
-
-    Args:
-        code (str): Error code.
-        pk (str | optional): The instance's primary key that triggered the error. Defaults to None.
-        value (str | optional): The instance's value that triggered the error. Defaults to None.
-    """
-
-    def __init__(self, code: str, pk: Optional[str] = None, value: Optional[str] = None):
-        self.code = code.upper()
-        self.pk = pk
-        self.value = value
-
-    @property
-    def _codes(self) -> list:
-        return [
-            func
-            for func in dir(self)
-            if func.isupper() and
-            callable(getattr(self, func)) and
-            not func.startswith("__")
-        ]
-
-    @property
-    def _messages(self) -> dict:
-        return {code: getattr(self, code) for code in self._codes}
-
-    @property
-    def message(self) -> str:
-        if not self._validate_code():
-            raise ValueError(f"{self.code} not found")
-        return self._messages[self.code]()
-
-    @property
-    def code(self) -> str:
-        return self._code
-
-    @code.setter
-    def code(self, code: str) -> None:
-        self._code = code.upper()
-
-    def _validate_code(self) -> bool:
-        return self.code in self._codes
-
-    @property
-    def pk(self) -> str:
-        return self._pk
-
-    @pk.setter
-    def pk(self, pk: str) -> None:
-        self._pk = pk
-
-    @property
-    def value(self) -> str:
-        return self._value
-
-    @value.setter
-    def value(self, value: str) -> None:
-        self._value = value
-
-    """
-        Excel File Structure Error Codes
-    """
-
-    def EXL00(self):
-        return f"The provided file '{self.pk}' is not an excel(xlsx) file"
-
-    def EFS01(self):
-        return "The 'Growth media' sheet is missing. Please check the provided excel template."
-
-    def EFS02(self):
-        return "The 'Geographic origin' sheet is missing. Please check the provided excel template."
-
-    def EFS03(self):
-        return "The 'Literature' sheet is missing. Please check the provided excel template."
-
-    def EFS04(self):
-        return "The 'Sexual state' sheet is missing. Please check the provided excel template."
-
-    def EFS05(self):
-        return "The 'Strains' sheet is missing. Please check the provided excel template."
-
-    def EFS06(self):
-        return "The 'Ontobiotope' sheet is missing. Please check the provided excel template."
-
-    def EFS07(self):
-        return "The 'Markers' sheet is missing. Please check the provided excel template."
-
-    def EFS08(self):
-        return "The 'Genomic information' sheet is missing. Please check the provided excel template."
-
-    """
-        Growth Media Error Codes
-    """
-
-    def GMD01(self):
-        return "The 'Acronym' column is a mandatory field in the Growth Media sheet."
-
-    def GMD02(self):
-        return "The 'Acronym' column is empty or has missing values."
-
-    def GMD03(self):
-        return "The 'Description' column is a mandatory field in the Growth Media sheet. The column can not be empty."
-
-    def GMD04(self):
-        return f"The 'Description' for growth media with Acronym {self.pk} is missing."
-
-    """
-        Geographic Origin Error Codes
-    """
-
-    def GOD01(self):
-        return "The 'ID' column is a mandatory field in the Geographic Origin sheet."
-
-    def GOD02(self):
-        return "The 'ID' column is empty or has missing values."
-
-    def GOD03(self):
-        return "The 'Country' column is a mandatory field in the Geographic Origin sheet. The column can not be empty."
-
-    def GOD04(self):
-        return f"The 'Country' for geographic origin with ID {self.pk} is missing."
-
-    def GOD05(self):
-        return f"The 'Country' for geographic origin with ID {self.pk} is incorrect."
-
-    def GOD06(self):
-        return f"The 'Locality' column is a mandatory field in the Geographic Origin sheet. The column can not be empty."
-
-    def GOD07(self):
-        return f"The 'Locality' for geographic origin with ID {self.pk} is missing."
-
-    """
-        Literature Error Codes
-    """
-
-    def LID01(self):
-        return "The 'ID' column is a mandatory field in the Literature sheet."
-
-    def LID02(self):
-        return "The 'ID' column empty or missing values."
-
-    def LID03(self):
-        return "The 'Full reference' column is a mandatory field in the Literature sheet. The column can not be empty."
-
-    def LID04(self):
-        return f"The 'Full reference' for literature with ID {self.pk} is missing."
-
-    def LID05(self):
-        return "The 'Authors' column is a mandatory field in the Literature sheet. The column can not be empty."
-
-    def LID06(self):
-        return f"The 'Authors' for literature with ID {self.pk} is missing."
-
-    def LID07(self):
-        return "The 'Title' column is a mandatory field in the Literature sheet. The column can not be empty."
-
-    def LID08(self):
-        return f"The 'Title' for literature with ID {self.pk} is missing."
-
-    def LID09(self):
-        return "The 'Journal' column is a mandatory field in the Literature sheet. The column can not be empty."
-
-    def LID10(self):
-        return f"The 'Journal' for literature with ID {self.pk} is missing."
-
-    def LID11(self):
-        return "The 'Year' column is a mandatory field in the Literature sheet. The column can not be empty."
-
-    def LID12(self,):
-        return f"The 'Year' for literature with ID {self.pk} is missing."
-
-    def LID13(self):
-        return "The 'Volume' column is a mandatory field in the Literature sheet. The column can not be empty."
-
-    def LID14(self):
-        return f"The 'Volume' for literature with ID {self.pk} is missing."
-
-    def LID15(self):
-        return "The 'First page' column is a mandatory field. The column can not be empty."
-
-    def LID16(self):
-        return f"The 'First page' for literature with ID {self.pk} is missing."
-
-    def LID17(self):
-        msg = 'If journal; Title, Authors, journal, year and first page are required'
-        msg += 'If Book; Book Title, Authors, Year, Editors, Publishers'
-        return msg
-
-    """
-        Strains Error Codes
-    """
-
-    def STD01(self):
-        return "The 'Accession number' column is a mandatory field in the Strains sheet."
-
-    def STD02(self):
-        return "The 'Accession number' column is empty or has missing values."
-
-    def STD03(self):
-        return f"The 'Accesion number' must be unique. The '{self.value}' is repeated."
-
-    def STD04(self):
-        return (f"The 'Accession number' {self.pk} is not according to the specification."
-                " The value must be of the format '<Sequence of characters> <sequence of characters>'.")
-
-    def STD05(self):
-        return f"The 'Restriction on use' column is a mandatory field in the Strains Sheet. The column can not be empty."
-
-    def STD06(self):
-        return f"The 'Restriction on use' for strain with Accession Number {self.pk} is missing."
-
-    def STD07(self):
-        return (f"The 'Restriction on use' for strain with Accession Number {self.pk} is not according to the specification."
-                f" Your value is {self.value} and the accepted values are 1, 2, 3.")
-
-    def STD08(self):
-        return f"The 'Nagoya protocol restrictions and compliance conditions' column is a mandatory field in the Strains Sheet. The column can not be empty."
-
-    def STD09(self):
-        return f"The 'Nagoya protocol restrictions and compliance conditions' for strain with Accession Number {self.pk} is missing."
-
-    def STD10(self):
-        return (f"The 'Nagoya protocol restrictions and compliance conditions' for strain with Accession Number {self.pk} is not according to the specification."
-                f" Your value is {self.value} and the accepted values are 1, 2, 3.")
-
-    def STD11(self):
-        return (f"The 'Strain from a registered collection' for strain with Accession Number {self.pk} is not according to specification."
-                f" Your value is {self.value} and the accepted values are 1, 2, 3.")
-
-    def STD12(self):
-        return "The 'Risk group' column is a mandatory field in the Strains Sheet. The column can not be empty."
-
-    def STD13(self):
-        return f"The 'Risk group' for strain with Accession Number {self.pk} is missing."
-
-    def STD14(self):
-        return (f"The 'Risk group' for strain with Accession Number {self.pk} is not according to specification."
-                f" Your value is {self.value} and the accepted values are 1, 2, 3, 4.")
-
-    def STD15(self):
-        return (f"The 'Dual use' for strain with Accession Number {self.pk} is not according to specification."
-                f" Your value is {self.value} and the accepted values are 1, 2.")
-
-    def STD16(self):
-        return (f"The “Quarantine in europe” for strain with Accession Number {self.pk} is not according to specification."
-                f" Your value is {self.value} and the accepted values are 1, 2.")
-
-    def STD17(self):
-        return f"The 'Organism type' column is a mandatory field in the Strains Sheet. The column can not be empty."
-
-    def STD18(self):
-        return f"The 'Organism type' for strain with Accession Number {self.pk} is missing."
-
-    def STD19(self):
-        return (f"The 'Organism type' for strain with Accession Number {self.pk} is not according to specification."
-                f" Your value is {self.value} and the accepted values are 'Algae', 'Archaea', 'Bacteria', 'Cyanobacteria', "
-                "'Filamentous Fungi',  'Phage', 'Plasmid', 'Virus', 'Yeast', 1, 2, 3, 4, 5, 6, 7, 8, 9.")
-
-    def STD20(self):
-        return f"The 'Taxon name' column is a mandatory field in the Strains Sheet. The column can not be empty."
-
-    def STD21(self):
-        return f"The 'Taxon name' for strain with Accession Number {self.pk} is missing."
-
-    def STD22(self):
-        return f"The 'Taxon name' for strain with Accession Number {self.pk} is incorrect."
-
-    def STD23(self):
-        return (f"The 'Interspecific hybrid' for strain with Accession Number {self.pk} is not according to specification."
-                f" Your value is {self.value} and the accepted values are 1, 2.")
-
-    def STD24(self):
-        return f"The 'History of deposit' for strain with Accession Number {self.pk} is incorrect."
-
-    def STD25(self):
-        return (f"The 'Date of deposit' for strain with Accession Number {self.pk} is incorrect."
-                " The allowed formats are 'YYYY-MM-DD', 'YYYYMMDD', 'YYYYMM', and 'YYYY'.")
-
-    def STD26(self):
-        return (f"The 'Date of inclusion in the catalogue' for strain with Accession Number {self.pk} is incorrect."
-                " The allowed formats are 'YYYY-MM-DD', 'YYYYMMDD', 'YYYYMM', and 'YYYY'.")
-
-    def STD27(self):
-        return (f"The 'Date of collection' for strain with Accession Number {self.pk} is incorrect."
-                " The allowed formats are 'YYYY-MM-DD', 'YYYYMMDD', 'YYYYMM', and 'YYYY'.")
-
-    def STD28(self):
-        return (f"The 'Date of isolation' for strain with Accession Number {self.pk} is incorrect."
-                " The allowed formats are 'YYYY-MM-DD', 'YYYYMMDD', 'YYYYMM', and 'YYYY'.")
-
-    def STD29(self):
-        return (f"The 'Tested temperature growth range' for strain with Accession Number {self.pk} is incorrect."
-                " It must have two decimal numbers separated by ','")
-
-    def STD30(self):
-        return f"The 'Recommended growth temperature' column is a mandatory field in the Strains Sheet. The column can not be empty."
-
-    def STD31(self):
-        return f"The 'Recommended growth temperature' for strain with Accession Number {self.pk} is missing."
-
-    def STD32(self):
-        return (f"The 'Recommended growth temperature' for strain with Accession Number {self.pk} is incorrect."
-                " It must have two decimal numbers separated by ','.")
-
-    def STD33(self):
-        return f"The 'Recommended medium for growth' column is a mandatory field in the Strains Sheet. The column can not be empty."
-
-    def STD34(self):
-        return f"The 'Recommended medium for growth' for strain with Accession Number {self.pk} is missing."
-
-    def STD35(self):
-        return f"The value of 'Recommended medium for growth' for strain with Accession Number {self.pk} is not in the Growth Media Sheet."
-
-    def STD36(self):
-        return f"The 'Forms of supply' column is a mandatory field in the Strains Sheet. The column can not be empty."
-
-    def STD37(self):
-        return f"The 'Forms of supply' for strain with Accession Number {self.pk} is missing."
-
-    def STD38(self):
-        return f"The value of 'Forms of supply' for strain with Accession Number {self.pk} is not in the Forms of Supply Sheet."
-
-    def STD39(self):
-        return (f"The 'Coordinates of geographic origin' column for strain with Accession Number {self.pk} is incorrect."
-                "The allowed formats are two or three decimal numbers separated by ','. Moreover, the first number must be"
-                "between [-90, 90], the second between [-180, 180], and the third, if provided, can assume any value.")
-
-    def STD40(self):
-        return (f"The 'Altitude of geographic origin' column for strain with Accession Number {self.pk} is incorrect."
-                "The allowed formats are one decimal number between [-200, 8000].")
-
-    def STD41(self):
-        return f"The value of 'Ontobiotope term for the isolation habitat' for strain with Accession Number {self.pk} is not in the Ontobiotope Sheet."
-
-    def STD42(self):
-        return (f"The 'GMO' for strain with Accession Number {self.pk} is not according to specification."
-                f" Your value is {self.value} and the accepted values are 1, 2")
-
-    def STD43(self):
-        return (f"The 'Sexual State' for strain with Accession Number {self.pk} is not according to specification."
-                f" Your value is {self.value} and the accepted values are 'Mata', 'Matalpha', 'Mata/Matalpha', "
-                "'Matb', 'Mata/Matb', 'MTLa', 'MTLalpha', 'MTLa/MTLalpha', 'MAT1-1', 'MAT1-2', 'MAT1', 'MAT2', 'MT+', 'MT-'")
-
-    def STD44(self):
-        return (f"The 'Ploidy' for strain with Accession Number {self.pk} is not according to specification."
-                f" Your value is {self.value} and the accepted values are 0, 1, 2, 3, 4, 9")
-
-    def STD45(self):
-        msg = f"At least one of the values '{self.value}' of the literature field for strain {self.pk} are not in the literature sheet. "
-        msg += "If the those values are Pubmed ids or DOIs, please ignore this messsage"
-        return msg
-
-    def STD46(self):
-        msg = f"If date of collection/isolation/deposit/inclusion in the catalog is after 2014," \
-              f" the value of column Geographic Origin must be provided and associated with a country in the " \
-              f"Geographic Origin sheet. The value is missing or not associated with a country for strain {self.pk}."
-        return msg
-
-
-    """
-        Genomic Information Error Codes
-    """
-
-    def GID01(self):
-        return f"The 'Strain Acession Number' (Strain AN) column is a mandatory field in the Genomic Information Sheet."
-
-    def GID02(self):
-        return f"The 'Strain Acession Number' (Strain AN) column is empty or has missing values."
-
-    def GID03(self):
-        return f"The value of 'Strain Acession Number' (Strain AN) {self.value} is not in the Strains sheet."
-
-    def GID04(self):
-        return f"The 'Marker' column is a mandatory field in the Genomic Information Sheet. The column can not be empty."
-
-    def GID05(self):
-        return f"The 'Marker' for genomic information with Strain AN {self.pk} is missing."
-
-    def GID06(self):
-        return f"The value of 'Marker' {self.value} is not in the Markers sheet."
-
-    def GID07(self):
-        return f"The 'INSDC AN' column is a mandatory field in the Genomic Information Sheet. The column can not be empty."
-
-    def GID08(self):
-        return f"The 'INSDC AN' for genomic information with Strain AN {self.pk} is missing."
-
-    def GID09(self):
-        return f"The 'INSDC AN' for genomic information with Strain AN {self.pk} is incorrect."
-
-    def GID10(self):
-        return (f"The 'Sequence' for genomic information with Strain AN {self.pk} is incorrect."
-                " It must be a sequence of 'G', 'T', 'A', 'C' characteres of any length and without white spaces.")
-
-    """
-        Ontobiotope Error Codes
-    """
-
-    def OTD01(self):
-        return "The 'ID' columns is a mandatory field in the Ontobiotope Sheet."
-
-    def OTD02(self):
-        return "The 'ID' columns is empty or has missing values."
-
-    def OTD03(self):
-        return "The 'Name' columns is a mandatory field in the Ontobiotope Sheet. The column can not be empty."
-
-    def OTD04(self):
-        return f"The 'Name' for ontobiotope with ID {self.pk} is missing."

requirements.txt

@@ -1,5 +0,0 @@
-openpyxl
-requests
-requests_oauthlib
-pycountry
-deepdiff

settings.py

@@ -3,6 +3,7 @@ from pathlib import Path
 DATA_DIR = Path(__file__).parent / "data"
 
 ACCESSION_NUMBER = "accession_number"
+MIRRI_ACCESSION_NUMBER = 'mirri_accession_number'
 RESTRICTION_ON_USE = "restriction_on_use"
 NAGOYA_PROTOCOL = "nagoya_protocol"
 ABS_RELATED_FILES = "abs_related_files"
@@ -14,6 +15,7 @@ DUAL_USE = "dual_use"
 QUARANTINE = "quarantine"
 ORGANISM_TYPE = "organism_type"
 TAXON_NAME = "taxon_name"
+TYPE = "type"
 INFRASUBSPECIFIC_NAME = "infrasubspecific_names"
 COMMENTS_ON_TAXONOMY = "comments_on_taxonomy"
 STATUS = "status"
@@ -54,6 +56,9 @@ SUBSTRATE_HOST_OF_ISOLATION = "substrate_host_of_isolation"
 ISOLATION_HABITAT = "isolation_habitat"
 ONTOBIOTOPE_ISOLATION_HABITAT = "ontobiotope_term_for_the_isolation_habitat"
 LITERATURE_LINKED_TO_SEQ_GENOME = "literature_linked_to_the_sequence_genome"
+AXENIC_CULTURE = "axenic_culture"
+QPS ="qps"
+SITE_LINK = "site_links"
 
 # StrainId
 STRAIN_ID = "id"
@@ -99,73 +104,80 @@ ALLOWED_COLLECTING_SITE_KEYS = [
 ]
 
 MIRRI_FIELDS = [
-    {"attribute": "id", "label": "Accession number"},
-    {"attribute": "restriction_on_use", "label": "Restrictions on use"},
+    {"attribute": "id", "label": "accessionNumber"},
+    {"attribute": "mirri_accession_number", "label": "mirriAccessionNumber"},
+    {"attribute": "qps", "label": "qps"},
+    {"attribute": "axenic_culture", "label": "axenicCulture"},
+    {"attribute": "restriction_on_use", "label": "useRestrictions"},
     {"attribute": "nagoya_protocol",
-        "label": "Nagoya protocol restrictions and compliance conditions"},
-    {"attribute": ABS_RELATED_FILES, "label": "ABS related files"},
-    {"attribute": "mta_files", "label": "MTA file"},
-    {"attribute": "other_numbers", "label": "Other culture collection numbers"},
+        "label": "nagoyaConditions"},
+    {"attribute": ABS_RELATED_FILES, "label": "absFile"},
+    {"attribute": "mta_files", "label": "mtaFile"},
+    {"attribute": "other_numbers", "label": "otherCollectionNumbers"},
     {"attribute": "is_from_registered_collection",
-        "label": "Strain from a registered collection"},
-    {"attribute": "risk_group", "label": "Risk Group"},
-    {"attribute": "is_potentially_harmful", "label": "Dual use"},
-    {"attribute": "is_subject_to_quarantine", "label": "Quarantine in Europe"},
-    {"attribute": "taxonomy.organism_type", "label": "Organism type"},
-    {"attribute": "taxonomy.taxon_name", "label": "Taxon name"},
+        "label": "registeredCollection"},
+    {"attribute": "risk_group", "label": "riskGroup"},
+    {"attribute": "is_potentially_harmful", "label": "dualUse"},
+    {"attribute": "is_subject_to_quarantine", "label": "euQuarantine"},
+    {"attribute": "taxonomy.organism_type", "label": "organismType"},
+    {"attribute": "taxonomy.taxon_name", "label": "speciesName"},
     {"attribute": "taxonomy.infrasubspecific_name",
-        "label": "Infrasubspecific names"},
-    {"attribute": "taxonomy.comments", "label": "Comment on taxonomy"},
+        "label": "infrasubspecificNames"},
+    {"attribute": "taxonomy.comments", "label": "taxonomyComments"},
     {"attribute": "taxonomy.interspecific_hybrid",
-        "label": "Interspecific hybrid"},
-    {"attribute": "status", "label": "Status"},
-    {"attribute": "history", "label": "History of deposit", },
-    {"attribute": "deposit.who", "label": "Depositor"},
-    {"attribute": "deposit.date", "label": "Date of deposit"},
+        "label": "hybrid"},
+    {"attribute": "status", "label": "status"},
+    {"attribute": "history", "label": "depositHistory", },
+    {"attribute": "deposit.who", "label": "depositor"},
+    {"attribute": "deposit.date", "label": "depositDate"},
     {"attribute": "catalog_inclusion_date",
-        "label": "Date of inclusion in the catalogue"},
-    {"attribute": "collect.who", "label": "Collected by"},
-    {"attribute": "collect.date", "label": "Date of collection"},
-    {"attribute": "isolation.who", "label": "Isolated by"},
-    {"attribute": "isolation.date", "label": "Date of isolation"},
+        "label": "accessionDate"},
+    {"attribute": "collect.who", "label": "collector"},
+    {"attribute": "collect.date", "label": "collectionDate"},
+    {"attribute": "isolation.who", "label": "isolator"},
+    {"attribute": "isolation.date", "label": "isolationDate"},
     {"attribute": "isolation.substrate_host_of_isolation",
-        "label": "Substrate/host of isolation"},
+        "label": "substrate"},
     {"attribute": "growth.tested_temp_range",
-        "label": "Tested temperature growth range"},
+        "label": "temperatureGrowthRange"},
     {"attribute": "growth.recommended_temp",
-        "label": "Recommended growth temperature"},
+        "label": "recommendedTemperature"},
     {"attribute": "growth.recommended_media",
-        "label": "Recommended medium for growth"},
-    {"attribute": "form_of_supply", "label": "Form of supply"},
-    {"attribute": "other_denominations", "label": "Other denomination"},
+        "label": "recommendedMedium"},
+    {"attribute": "form_of_supply", "label": "supplyForms"},
+    {"attribute": "other_denominations", "label": "otherDenomination"},
     {"attribute": "collect.location.coords",
-        "label": "Coordinates of geographic origin"},
+        "label": "geographicCoordinates"},
+    {"attribute": "collect.site.links",
+        "label": "siteLinks"}, 
     {"attribute": "collect.location.altitude",
-        "label": "Altitude of geographic origin"},
-    {"attribute": "collect.location", "label": "Geographic origin"},
-    {"attribute": "collect.habitat", "label": "Isolation habitat"},
+        "label": "country"},
+    {"attribute": "collect.location", "label": "geographicOrigin"},
+    {"attribute": "collect.habitat", "label": "isolationHabitat"},
     {"attribute": "collect.habitat_ontobiotope",
-        "label": "Ontobiotope term for the isolation habitat"},
-    {"attribute": "genetics.gmo", "label": "GMO"},
+        "label": "ontobiotopeTerms"},
+    {"attribute": "genetics.gmo", "label": "gmo"},
     {"attribute": "genetics.gmo_construction",
-        "label": "GMO construction information"},
-    {"attribute": "genetics.mutant_info", "label": "Mutant information"},
-    {"attribute": "genetics.genotype", "label": "Genotype"},
-    {"attribute": "genetics.sexual_state", "label": "Sexual state"},
-    {"attribute": "genetics.ploidy", "label": "Ploidy"},
-    {"attribute": "genetics.plasmids", "label": "Plasmids"},
+        "label": "gmoConstruction"},
+    {"attribute": "genetics.mutant_info", "label": "mutant"},
+    {"attribute": "genetics.genotype", "label": "genotype"},
+    {"attribute": "genetics.sexual_state", "label": "sexualState"},
+    {"attribute": "genetics.ploidy", "label": "ploidy"},
+    {"attribute": "genetics.plasmids", "label": "plasmids"},
     {"attribute": "genetics.plasmids_in_collections",
-        "label": "Plasmids collections fields"},
-    {"attribute": "publications", "label": "Literature"},
+        "label": "plasmidCollections"},
+    {"attribute": "publications", "label": "identificationLiterature"},
     {"attribute": PLANT_PATHOGENICITY_CODE, "label": "Plant pathogenicity code"},
-    {"attribute": "pathogenicity", "label": "Pathogenicity"},
-    {"attribute": "enzyme_production", "label": "Enzyme production"},
+    {"attribute": "pathogenicity", "label": "pathogenicity"},
+    {"attribute": "enzyme_production", "label": "enzymes"},
     {"attribute": "production_of_metabolites",
-        "label": "Production of metabolites"},
-    {"attribute": "applications", "label": "Applications", },
-    {"attribute": "remarks", "label": "Remarks"},
+        "label": "metabolites"},
+    {"attribute": "type",
+        "label": "type"},
+    {"attribute": "applications", "label": "applications", },
+    {"attribute": "remarks", "label": "remarks"},
     {"attribute": LITERATURE_LINKED_TO_SEQ_GENOME,
-        "label": "Literature linked to the sequence/genome"},
+        "label": "sequenceLiterature"},
 ]
 
 ALLOWED_SUBTAXA = ["subspecies", "variety", "convarietas", "group", "forma",
@@ -228,8 +240,9 @@ ALLOWED_MARKER_TYPES = [
 ]
 
 PUBLICATIONS = "publications"
-PUB_ID = "id"
+PUB_ID = "pub_id"
 PUB_DOI = "pub_doi"
+PUB_PMID = "pub_pmid"
 PUB_PUBMED_ID = ''
 PUB_FULL_REFERENCE = "full_reference"
 PUB_TITLE = "title"
@@ -247,6 +260,8 @@ BOOK_PUBLISHER = "book_publisher"
 
 PUBLICATION_FIELDS = [
     {"label": "ID", "attribute": PUB_ID},
+    {"label": "PMID", "attribute": PUB_PMID},
+    {"label": "DOI", "attribute": PUB_DOI},
     {"label": "Full reference", "attribute": PUB_FULL_REFERENCE},
     {"label": "Authors", "attribute": PUB_AUTHORS},
     {"label": "Title", "attribute": PUB_TITLE},
@@ -282,15 +297,43 @@ SUBTAXAS = {
     "f.sp.": "forma.specialis"
 }
 
+#Control
+VERSION = "Version"
+DATE = "Date"
+
+
+#Country codes
+COUNTRY = "Country"
+CODE = "Code"
+ADDITIONAL_INFORMATION_ON_THE_COUNTRY_OR_CODE = "Additional information on the country or code"
+
+
+#Country codes files
+COUNTRY_CODES_SHEET = [
+    {"label": "Country", "attribute": COUNTRY},
+    {"label": "Code", "attribute": CODE},
+    {"label": "Additional information on the country or code", "attribute": ADDITIONAL_INFORMATION_ON_THE_COUNTRY_OR_CODE},
+]
+
+
+#Controle files
+CONTROL_FIELDS = [
+    {"label": "Version", "attribute": VERSION},
+    {"label": "Date", "attribute": DATE},
+]
+
 # Excel sheet name
 LOCATIONS = "Geographic origin"  # 'Locations'
 GROWTH_MEDIA = "Growth media"
 GENOMIC_INFO = "Genomic information"
 STRAINS = "Strains"
 LITERATURE_SHEET = "Literature"
-SEXUAL_STATE_SHEET = "Sexual states"
+SEXUAL_STATE_SHEET = "Sexual state"
 RESOURCE_TYPES_VALUES = "Resource types values"
 FORM_OF_SUPPLY_SHEET = "Forms of supply"
 PLOIDY_SHEET = "Ploidy"
 ONTOBIOTOPE = "Ontobiotope"
 MARKERS = "Markers"
+CONTROL_SHEET = "Version"
+COUNTRY_CODES_SHEET = "Country codes"
+RESOURCE_SHEET = 'Resource types values'

setup.py

@@ -1,35 +0,0 @@
-import setuptools
-from pathlib import Path
-from setuptools import find_packages
-
-with open("README.md", "r") as fh:
-    long_description = fh.read()
-
-requirements = [line.strip() for line in open('requirements.txt')]
-scripts = [str(f) for f in Path('./bin').glob('*.py')]
-
-setuptools.setup(
-    name="Mirri utils",  # Replace with your own username
-    version=0.1,
-    author="P.Ziarsolo",
-    author_email="pziarsolo@gmail.com",
-    description="A small library to help dealing with MIRRI data",
-    long_description=long_description,
-    long_description_content_type="text/markdown",
-    url="https://github.com/pziarsolo/mirri_utils",
-    packages=find_packages(),
-    package_data={"mirri": ['data/ontobiotopes.csv']},
-    # package_dir={"mirri.entities": "mirri.entities"
-    #              "mirri.io.parsers": "mirri.io.parsers",
-    #              "mirri.io.writers": "mirri.io.writers",
-    #              'mirri.validation': 'mirri.vallidation'},
-    install_requires=requirements,
-    scripts=scripts,
-    license="GNU General Public License v3.0",
-    classifiers=[
-        "Programming Language :: Python :: 3",
-        "License :: OSI Approved :: MIT License",
-        "Operating System :: OS Independent",
-    ],
-    python_requires='>=3.6',
-)

tests/biolomics/test_auth_operations.py

@@ -1,22 +0,0 @@
-import unittest
-
-from mirri.biolomics.remote.rest_client import BiolomicsClient
-try:
-    from mirri.biolomics.secrets import CLIENT_ID, SECRET_ID, USERNAME, PASSWORD
-except ImportError:
-    raise ImportError(
-        'You need a secrets.py in the project dir. with CLIENT_ID, SECRET_ID, USERNAME, PASSWORD')
-
-from .utils import VERSION, SERVER_URL
-
-
-class BiolomicsClientAuthTest(unittest.TestCase):
-
-     def test_authentication(self):
-        client = BiolomicsClient(SERVER_URL, VERSION, CLIENT_ID, SECRET_ID,
-                                 USERNAME, PASSWORD)
-        access1 = client.get_access_token()
-        access2 = client.get_access_token()
-        assert access1 is not None
-        self.assertEqual(access1, access2)
-

tests/biolomics/test_growth_medium_operations.py

@@ -1,62 +0,0 @@
-import unittest
-
-from mirri.biolomics.remote.endoint_names import GROWTH_MEDIUM_WS
-from mirri.biolomics.serializers.growth_media import GrowthMedium
-from mirri.biolomics.settings import CLIENT_ID, SECRET_ID, USERNAME, PASSWORD
-from mirri.biolomics.remote.biolomics_client import BiolomicsMirriClient
-from tests.biolomics.utils import SERVER_URL, VERSION
-
-
-class BiolomicsSequenceClientTest(unittest.TestCase):
-    def setUp(self):
-        self.client = BiolomicsMirriClient(SERVER_URL, VERSION, CLIENT_ID,
-                                           SECRET_ID, USERNAME, PASSWORD)
-
-    def test_retrieve_media_by_id(self):
-        record_id = 101
-        growth_medium = self.client.retrieve_by_id('growth_medium', record_id)
-        self.assertEqual(growth_medium.record_id, record_id)
-
-        self.assertEqual(growth_medium.record_name, 'MA2PH6')
-
-    def test_retrieve_media_by_id(self):
-        record_name = 'MA2PH6'
-        record_id = 101
-        growth_medium = self.client.retrieve_by_name('growth_medium', record_name)
-        self.assertEqual(growth_medium.record_id, record_id)
-        self.assertEqual(growth_medium.record_name, record_name)
-
-    def test_create_growth_media(self):
-        self.client.start_transaction()
-        try:
-            growth_medium = GrowthMedium()
-            growth_medium.acronym = 'BBB'
-            growth_medium.ingredients = 'alkhdflakhf'
-            growth_medium.description = 'desc'
-
-            new_growth_medium = self.client.create(GROWTH_MEDIUM_WS, growth_medium)
-            print(new_growth_medium.dict())
-        finally:
-            self.client.rollback()
-
-    def test_update_growth_media(self):
-        self.client.start_transaction()
-        try:
-            growth_medium = GrowthMedium()
-            growth_medium.acronym = 'BBB'
-            growth_medium.ingredients = 'alkhdflakhf'
-            growth_medium.description = 'desc'
-            growth_medium.full_description = 'full'
-            new_growth_medium = self.client.create(GROWTH_MEDIUM_WS, growth_medium)
-
-            new_growth_medium.full_description = 'full2'
-            updated_gm = new_growth_medium = self.client.update(GROWTH_MEDIUM_WS, new_growth_medium)
-            self.assertEqual(updated_gm.full_description, new_growth_medium.full_description)
-
-            retrieved = self.client.retrieve_by_id(GROWTH_MEDIUM_WS, new_growth_medium.record_id)
-            self.assertEqual(retrieved.full_description, updated_gm.full_description)
-
-        finally:
-            self.client.rollback()
-
-

tests/biolomics/test_literature_operations.py

@@ -1,46 +0,0 @@
-import unittest
-
-from .utils import VERSION, SERVER_URL
-from mirri.biolomics.settings import CLIENT_ID, SECRET_ID, USERNAME, PASSWORD
-from mirri.biolomics.remote.biolomics_client import BiolomicsMirriClient, BIBLIOGRAPHY_WS
-from mirri.entities.publication import Publication
-
-
-class BiolomicsLiteratureClientTest(unittest.TestCase):
-    def setUp(self):
-        self.client = BiolomicsMirriClient(SERVER_URL, VERSION, CLIENT_ID,
-                                           SECRET_ID, USERNAME, PASSWORD)
-
-    def test_retrieve_biblio_by_id(self):
-        record_id = 100
-        record_name = "Miscellaneous notes on Mucoraceae"
-        biblio = self.client.retrieve_by_id(BIBLIOGRAPHY_WS, record_id)
-        self.assertEqual(biblio.record_id, record_id)
-
-        self.assertEqual(biblio.record_name, record_name)
-
-    def test_retrieve_media_by_id(self):
-        record_id = 100
-        record_name = "Miscellaneous notes on Mucoraceae"
-        biblio = self.client.retrieve_by_name(BIBLIOGRAPHY_WS, record_name)
-        self.assertEqual(biblio.record_id, record_id)
-        self.assertEqual(biblio.record_name, record_name)
-        self.assertEqual(biblio.year, 1994)
-        self.assertEqual(biblio.volume, '50')
-
-    def test_create_biblio(self):
-        pub = Publication()
-        pub.pubmed_id = 'PM18192'
-        pub.journal = 'my_journal'
-        pub.title = 'awesome title'
-        pub.authors = 'pasdas, aposjdasd, alsalsfda'
-        pub.volume = 'volume 0'
-        record_id = None
-        try:
-            new_pub = self.client.create(BIBLIOGRAPHY_WS, pub)
-            record_id = new_pub.record_id
-            self.assertEqual(new_pub.title, pub.title)
-            self.assertEqual(new_pub.volume, pub.volume)
-        finally:
-            if record_id is not None:
-                self.client.delete_by_id(BIBLIOGRAPHY_WS, record_id)

tests/biolomics/test_sequence_operations.py

@@ -1,49 +0,0 @@
-import unittest
-
-from mirri.biolomics.settings import CLIENT_ID, SECRET_ID, USERNAME, PASSWORD
-from mirri.biolomics.remote.biolomics_client import BiolomicsMirriClient
-from mirri.biolomics.serializers.sequence import GenomicSequenceBiolomics
-from .utils import VERSION, SERVER_URL
-
-
-class BiolomicsSequenceClientTest(unittest.TestCase):
-    def setUp(self) -> None:
-        self.client = BiolomicsMirriClient(SERVER_URL, VERSION, CLIENT_ID,
-                                           SECRET_ID, USERNAME, PASSWORD)
-
-    def test_retrieve_seq_by_id(self):
-        record_id = 101
-        sequence = self.client.retrieve_by_id('sequence', record_id)
-
-        self.assertEqual(sequence.record_id, record_id)
-        self.assertEqual(sequence.record_name, 'MUM 02.54 - CaM')
-        self.assertEqual(sequence.marker_type, 'CaM')
-
-    def test_retrieve_seq_by_name(self):
-        record_name = 'MUM 02.54 - CaM'
-        sequence = self.client.retrieve_by_name('sequence', record_name)
-
-        self.assertEqual(sequence.record_id, 101)
-        self.assertEqual(sequence.record_name, record_name)
-        self.assertEqual(sequence.marker_type, 'CaM')
-
-    def test_create_delete_sequence(self):
-        marker = GenomicSequenceBiolomics()
-        marker.marker_id = 'GGAAUUA'
-        marker.marker_seq = 'aattgacgat'
-        marker.marker_type = 'CaM'
-        marker.record_name = 'peioMarker'
-
-        new_marker = self.client.create('sequence', marker)
-        self.assertEqual(new_marker.marker_id, 'GGAAUUA')
-        self.assertEqual(new_marker.marker_seq, 'aattgacgat')
-        self.assertEqual(new_marker.marker_type, 'CaM')
-        self.assertEqual(new_marker.record_name, 'peioMarker')
-        self.assertTrue(new_marker.record_id)
-
-        self.client.delete_by_id('sequence', new_marker.record_id)
-
-
-if __name__ == "__main__":
-    # import sys;sys.argv = ['', 'BiolomicsClient.Test.test_get_strain_by_id']
-    unittest.main()

tests/biolomics/test_serializers.py

@@ -1,727 +0,0 @@
-import unittest
-import pycountry
-import deepdiff
-from pprint import pprint
-from mirri.biolomics.serializers.sequence import (
-    GenomicSequenceBiolomics,
-    serialize_to_biolomics as sequence_to_biolomics,
-    serialize_from_biolomics as sequence_from_biolomics)
-
-from mirri.biolomics.serializers.strain import (
-    serialize_to_biolomics as strain_to_biolomics,
-    serialize_from_biolomics as strain_from_biolomics)
-from mirri.biolomics.serializers.growth_media import (
-    # serialize_to_biolomics as growth_medium_to_biolomics,
-    serialize_from_biolomics as growth_medium_from_biolomics)
-from mirri.biolomics.serializers.bibliography import (
-    serializer_from_biolomics as literature_from_biolomics,
-    serializer_to_biolomics as literature_to_biolomics
-)
-from mirri.biolomics.settings import CLIENT_ID, SECRET_ID, USERNAME, PASSWORD
-from mirri.biolomics.remote.biolomics_client import BiolomicsMirriClient
-from mirri.entities.publication import Publication
-from .utils import create_full_data_strain, VERSION, SERVER_URL
-
-
-STRAIN_WS = {
-    'CreationDate': '2021-05-19T12:22:33',
-    'CreatorUserName': 'pziarsolo@cect.org',
-    'LastChangeDate': '2021-05-19T12:22:36',
-    'LastChangeUserName': 'pziarsolo@cect.org',
-    'RecordDetails': {'ABS related files': {'FieldType': 21,
-                                            'Value': [{'Name': 'link',
-                                                       'Value': 'https://example.com'}]},
-                      'Altitude of geographic origin': {'FieldType': 4,
-                                                        'Value': 121.0},
-                      'Applications': {'FieldType': 5, 'Value': 'health'},
-                      'Catalog URL': {'FieldType': 21, 'Value': []},
-                      'Collection accession number': {'FieldType': 5,
-                                                      'Value': 'TESTCC 1'},
-                      'Collection date': {'FieldType': 8, 'Value': '1991/01/01'},
-                      'Collector': {'FieldType': 5, 'Value': 'the collector'},
-                      'Comment on taxonomy': {'FieldType': 5,
-                                              'Value': 'lalalalla'},
-                      'Coordinates of geographic origin': {'FieldType': 12,
-                                                           'Value': {'Altitude': 0.0,
-                                                                     'Latitude': 23.3,
-                                                                     'Longitude': 23.3,
-                                                                     'Precision': 0.0}},
-                      'Country': {'FieldType': 118,
-                                  'Value': [{'Name': {'FieldType': 5,
-                                                      'Value': 'Spain'},
-                                             'RecordId': 54,
-                                             'TargetFieldValue': None}]},
-                      'Data provided by': {'FieldType': 22, 'Value': 'Unknown'},
-                      'Date of inclusion in the catalogue': {'FieldType': 8,
-                                                             'Value': '1985/05/02'},
-                      'Deposit date': {'FieldType': 8, 'Value': '1985/05/02'},
-                      'Depositor': {'FieldType': 5,
-                                    'Value': 'NCTC, National Collection of Type '
-                                             'Cultures - NCTC, London, United '
-                                             'Kingdom of Great Britain and '
-                                             'Northern Ireland.'},
-                      'Dual use': {'FieldType': 20, 'Value': 'yes'},
-                      'Enzyme production': {'FieldType': 5,
-                                            'Value': 'some enzimes'},
-                      'Form': {'FieldType': 3,
-                               'Value': [{'Name': 'Agar', 'Value': 'yes'},
-                                         {'Name': 'Cryo', 'Value': 'no'},
-                                         {'Name': 'Dry Ice', 'Value': 'no'},
-                                         {'Name': 'Liquid Culture Medium',
-                                          'Value': 'no'},
-                                         {'Name': 'Lyo', 'Value': 'yes'},
-                                         {'Name': 'Oil', 'Value': 'no'},
-                                         {'Name': 'Water', 'Value': 'no'}]},
-                      'GMO': {'FieldType': 22, 'Value': 'Yes'},
-                      'GMO construction information': {'FieldType': 5,
-                                                       'Value': 'instructrion to '
-                                                                'build'},
-                      'Genotype': {'FieldType': 5, 'Value': 'some genotupe'},
-                      'Geographic origin': {'FieldType': 5,
-                                            'Value': 'una state; one '
-                                                     'municipality; somewhere in '
-                                                     'the world'},
-                      'History': {'FieldType': 5,
-                                  'Value': 'newer < In the middle < older'},
-                      'Infrasubspecific names': {'FieldType': 5,
-                                                 'Value': 'serovar tete'},
-                      'Interspecific hybrid': {'FieldType': 20, 'Value': 'no'},
-                      'Isolation date': {'FieldType': 8, 'Value': '1900/01/01'},
-                      'Isolation habitat': {'FieldType': 5,
-                                            'Value': 'some habitat'},
-                      'Isolator': {'FieldType': 5, 'Value': 'the isolator'},
-                      'Literature': {'FieldType': 118, 'Value': []},
-                      'MTA files URL': {'FieldType': 21,
-                                        'Value': [{'Name': 'link',
-                                                   'Value': 'https://example.com'}]},
-                      'MTA text': {'FieldType': 5, 'Value': ''},
-                      'Metabolites production': {'FieldType': 5,
-                                                 'Value': 'big factory of cheese'},
-                      'Mutant information': {'FieldType': 5, 'Value': 'x-men'},
-                      'Nagoya protocol restrictions and compliance conditions': {'FieldType': 20,
-                                                                                 'Value': 'no '
-                                                                                          'known '
-                                                                                          'restrictions '
-                                                                                          'under '
-                                                                                          'the '
-                                                                                          'Nagoya '
-                                                                                          'protocol'},
-                      'Ontobiotope': {'FieldType': 118,
-                                      'Value': [{'Name': {'FieldType': 5,
-                                                          'Value': 'anaerobic '
-                                                                   'bioreactor '
-                                                                   '(OBT:000190)'},
-                                                 'RecordId': 100,
-                                                 'TargetFieldValue': None}]},
-                      'Ontobiotope term for the isolation habitat': {'FieldType': 5,
-                                                                     'Value': ''},
-                      'Orders': {'FieldType': 118, 'Value': []},
-                      'Organism type': {'FieldType': 3,
-                                        'Value': [{'Name': 'Algae', 'Value': 'no'},
-                                                  {'Name': 'Archaea',
-                                                   'Value': 'yes'},
-                                                  {'Name': 'Bacteria',
-                                                   'Value': 'no'},
-                                                  {'Name': 'Cyanobacteria',
-                                                   'Value': 'no'},
-                                                  {'Name': 'Filamentous Fungi',
-                                                   'Value': 'no'},
-                                                  {'Name': 'Phage', 'Value': 'no'},
-                                                  {'Name': 'Plasmid',
-                                                   'Value': 'no'},
-                                                  {'Name': 'Virus', 'Value': 'no'},
-                                                  {'Name': 'Yeast', 'Value': 'no'},
-                                                  {'Name': 'Microalgae',
-                                                   'Value': '?'}]},
-                      'Other culture collection numbers': {'FieldType': 5,
-                                                           'Value': 'aaa a; aaa3 '
-                                                                    'a3'},
-                      'Other denomination': {'FieldType': 5, 'Value': ''},
-                      'Pathogenicity': {'FieldType': 5, 'Value': 'illness'},
-                      'Plasmids': {'FieldType': 5, 'Value': 'asda'},
-                      'Plasmids collections fields': {'FieldType': 5,
-                                                      'Value': 'asdasda'},
-                      'Ploidy': {'FieldType': 20, 'Value': 'Polyploid'},
-                      'Quarantine in Europe': {'FieldType': 20, 'Value': 'no'},
-                      'Recommended growth medium': {'FieldType': 118,
-                                                    'Value': [{'Name': {'FieldType': 5,
-                                                                        'Value': 'AAA'},
-                                                               'RecordId': 1,
-                                                               'TargetFieldValue': None}]},
-                      'Recommended growth temperature': {'FieldType': 19,
-                                                         'MaxValue': 30.0,
-                                                         'MinValue': 30.0},
-                      'Remarks': {'FieldType': 5, 'Value': 'no remarks for me'},
-                      'Restrictions on use': {'FieldType': 20,
-                                              'Value': 'no restriction apply'},
-                      'Risk group': {'FieldType': 20, 'Value': '1'},
-                      'Sequences 16s': {"Value": [
-                          {
-                              "Name": {
-                                  "Value": "X76436",
-                                  "FieldType": 5
-                              },
-                              "RecordId": 50992,
-                              "TargetFieldValue": {
-                                  "Value": {
-                                      "Sequence": ""
-                                  },
-                                  "FieldType": 14
-                              }
-                          }
-                      ],
-                         "FieldType": 114},
-                      'Sequences 18S rRNA': {'FieldType': 114, 'Value': []},
-                      'Sequences 23S rRNA': {'FieldType': 114, 'Value': []},
-                      'Sequences ACT': {'FieldType': 114, 'Value': []},
-                      'Sequences AmdS': {'FieldType': 114, 'Value': []},
-                      'Sequences Amds12': {'FieldType': 114, 'Value': []},
-                      'Sequences Beta tubulin': {'FieldType': 114, 'Value': []},
-                      'Sequences COX1': {'FieldType': 114, 'Value': []},
-                      'Sequences COX2': {'FieldType': 114, 'Value': []},
-                      'Sequences CaM': {'FieldType': 114, 'Value': []},
-                      'Sequences Cct8': {'FieldType': 114, 'Value': []},
-                      'Sequences Cit1': {'FieldType': 114, 'Value': []},
-                      'Sequences CypA': {'FieldType': 114, 'Value': []},
-                      'Sequences GDP': {'FieldType': 114, 'Value': []},
-                      'Sequences GPD': {'FieldType': 114, 'Value': []},
-                      'Sequences Genome': {'FieldType': 114, 'Value': []},
-                      'Sequences HIS': {'FieldType': 114, 'Value': []},
-                      'Sequences HSP': {'FieldType': 114, 'Value': []},
-                      'Sequences IDH': {'FieldType': 114, 'Value': []},
-                      'Sequences IGS': {'FieldType': 114, 'Value': []},
-                      'Sequences ITS': {'FieldType': 114, 'Value': []},
-                      'Sequences LSU': {'FieldType': 114, 'Value': []},
-                      'Sequences MAT': {'FieldType': 114, 'Value': []},
-                      'Sequences MAT1': {'FieldType': 114, 'Value': []},
-                      'Sequences Miscellaneous': {'FieldType': 114, 'Value': []},
-                      'Sequences NorA': {'FieldType': 114, 'Value': []},
-                      'Sequences NorB': {'FieldType': 114, 'Value': []},
-                      'Sequences Omt12': {'FieldType': 114, 'Value': []},
-                      'Sequences OmtA': {'FieldType': 114, 'Value': []},
-                      'Sequences PcCYP': {'FieldType': 114, 'Value': []},
-                      'Sequences PpgA': {'FieldType': 114, 'Value': []},
-                      'Sequences PreA': {'FieldType': 114, 'Value': []},
-                      'Sequences PreB': {'FieldType': 114, 'Value': []},
-                      'Sequences RAPD': {'FieldType': 114, 'Value': []},
-                      'Sequences RPB1': {'FieldType': 114, 'Value': []},
-                      'Sequences RPB2': {'FieldType': 114, 'Value': []},
-                      'Sequences SSU': {'FieldType': 114, 'Value': []},
-                      'Sequences TEF1a': {'FieldType': 114, 'Value': []},
-                      'Sequences TEF2': {'FieldType': 114, 'Value': []},
-                      'Sequences TUB': {'FieldType': 114, 'Value': []},
-                      'Sequences Tsr1': {'FieldType': 114, 'Value': []},
-                      'Sequences c16S rRNA': {'FieldType': 114, 'Value': []},
-                      'Sequences cbhI': {'FieldType': 114, 'Value': []},
-                      'Sequences mcm7': {'FieldType': 114, 'Value': []},
-                      'Sequences rbcL': {'FieldType': 114, 'Value': []},
-                      'Sexual state': {'FieldType': 5, 'Value': 'MT+A'},
-                      'Status': {'FieldType': 5,
-                                 'Value': 'type of Bacillus alcalophilus'},
-                      'Strain from a registered collection': {'FieldType': 20,
-                                                              'Value': 'no'},
-                      'Substrate of isolation': {'FieldType': 5,
-                                                 'Value': 'some substrate'},
-                      'Taxon name': {'FieldType': 109,
-                                     'Value': [{'Name': {'FieldType': 5,
-                                                         'Value': 'Escherichia '
-                                                                  'coli'},
-                                                'RecordId': 100004123,
-                                                'TargetFieldValue': {'DesktopInfo': None,
-                                                                     'DesktopInfoHtml': '<b>Current '
-                                                                                        'name: '
-                                                                                        '</b><i>Escherichia '
-                                                                                        'coli</i> '
-                                                                                        '(Migula '
-                                                                                        '1895) '
-                                                                                        'Castellani '
-                                                                                        'and '
-                                                                                        'Chalmers '
-                                                                                        '1919',
-                                                                     'FieldType': 27,
-                                                                     'NewSynFieldInfo': None,
-                                                                     'ObligateSynonymId': 0,
-                                                                     'OriginalSynFieldInfo': None,
-                                                                     'SynInfo': {'BasionymRecord': {'NameInfo': '',
-                                                                                                    'RecordId': 100004123,
-                                                                                                    'RecordName': '<i>Escherichia '
-                                                                                                                  'coli</i> '
-                                                                                                                  '(Migula '
-                                                                                                                  '1895) '
-                                                                                                                  'Castellani '
-                                                                                                                  'and '
-                                                                                                                  'Chalmers '
-                                                                                                                  '1919',
-                                                                                                    'SecondLevelRecords': None},
-                                                                                 'CurrentNameRecord': {'NameInfo': '',
-                                                                                                       'RecordId': 100004123,
-                                                                                                       'RecordName': '<i>Escherichia '
-                                                                                                                     'coli</i> '
-                                                                                                                     '(Migula '
-                                                                                                                     '1895) '
-                                                                                                                     'Castellani '
-                                                                                                                     'and '
-                                                                                                                     'Chalmers '
-                                                                                                                     '1919',
-                                                                                                       'SecondLevelRecords': None},
-                                                                                 'ObligateSynonymRecords': [],
-                                                                                 'SelectedRecord': {
-                                                                                     'NameInfo': '<i>Escherichia '
-                                                                                                 'coli</i> '
-                                                                                                 '(Migula '
-                                                                                                 '1895) '
-                                                                                                 'Castellani '
-                                                                                                 'and '
-                                                                                                 'Chalmers '
-                                                                                                 '1919',
-                                                                                     'RecordId': 100004123,
-                                                                                     'RecordName': '<i>Escherichia '
-                                                                                                   'coli</i> '
-                                                                                                   '(Migula '
-                                                                                                   '1895) '
-                                                                                                   'Castellani '
-                                                                                                   'and '
-                                                                                                   'Chalmers '
-                                                                                                   '1919',
-                                                                                     'SecondLevelRecords': None},
-                                                                                 'TaxonSynonymsRecords': []},
-                                                                     'SynonymId': 100004123}}]},
-                      'Tested temperature growth range': {'FieldType': 19,
-                                                          'MaxValue': 32.0,
-                                                          'MinValue': 29.0},
-                      'Type description': {'FieldType': 5, 'Value': ''}},
-    'RecordId': 148038,
-    'RecordName': 'MIRRI 2240561'}
-
-STRAIN_WS_EXPECTED_NO_REMOTE = {
-    'Acronym': 'MIRRI',
-    'RecordDetails': {'ABS related files': {'FieldType': 'U',
-                                            'Value': [{'Name': 'link',
-                                                       'Value': 'https://example.com'}]},
-                      'Altitude of geographic origin': {'FieldType': 'D',
-                                                        'Value': 121},
-                      'Applications': {'FieldType': 'E', 'Value': 'health'},
-                      'Collection accession number': {'FieldType': 'E',
-                                                      'Value': 'TESTCC 1'},
-                      'Collection date': {'FieldType': 'H', 'Value': '1991-01-01'},
-                      'Collector': {'FieldType': 'E', 'Value': 'the collector'},
-                      'Comment on taxonomy': {'FieldType': 'E',
-                                              'Value': 'lalalalla'},
-                      'Coordinates of geographic origin': {'FieldType': 'L',
-                                                           'Value': {'Latitude': 23.3,
-                                                                     'Longitude': 23.3}},
-                      'Date of inclusion in the catalogue': {'FieldType': 'H',
-                                                             'Value': '1985-05-02'},
-                      'Deposit date': {'FieldType': 'H', 'Value': '1985-05-02'},
-                      'Depositor': {'FieldType': 'E',
-                                    'Value': 'NCTC, National Collection of Type '
-                                             'Cultures - NCTC, London, United '
-                                             'Kingdom of Great Britain and '
-                                             'Northern Ireland.'},
-                      'Dual use': {'FieldType': 'T', 'Value': 'yes'},
-                      'Enzyme production': {'FieldType': 'E',
-                                            'Value': 'some enzimes'},
-                      'Form': {'FieldType': 'C',
-                               'Value': [{'Name': 'Agar', 'Value': 'yes'},
-                                         {'Name': 'Cryo', 'Value': 'no'},
-                                         {'Name': 'Dry Ice', 'Value': 'no'},
-                                         {'Name': 'Liquid Culture Medium',
-                                          'Value': 'no'},
-                                         {'Name': 'Lyo', 'Value': 'yes'},
-                                         {'Name': 'Oil', 'Value': 'no'},
-                                         {'Name': 'Water', 'Value': 'no'}]},
-                      'GMO': {'FieldType': 'V', 'Value': 'Yes'},
-                      'GMO construction information': {'FieldType': 'E',
-                                                       'Value': 'instructrion to '
-                                                                'build'},
-                      'Genotype': {'FieldType': 'E', 'Value': 'some genotupe'},
-                      'Geographic origin': {'FieldType': 'E',
-                                            'Value': 'una state; one '
-                                                     'municipality; somewhere in '
-                                                     'the world'},
-                      'History': {'FieldType': 'E',
-                                  'Value': 'firstplave < seconn place < third '
-                                           'place'},
-                      'Infrasubspecific names': {'FieldType': 'E',
-                                                 'Value': 'serovar tete'},
-                      'Interspecific hybrid': {'FieldType': 'T', 'Value': 'no'},
-                      'Isolation date': {'FieldType': 'H', 'Value': '1900-01-01'},
-                      'Isolation habitat': {'FieldType': 'E',
-                                            'Value': 'some habitat'},
-                      'Isolator': {'FieldType': 'E', 'Value': 'the isolator'},
-                      'MTA files URL': {'FieldType': 'U',
-                                        'Value': [{'Name': 'link',
-                                                   'Value': 'https://example.com'}]},
-                      'Metabolites production': {'FieldType': 'E',
-                                                 'Value': 'big factory of cheese'},
-                      'Mutant information': {'FieldType': 'E', 'Value': 'x-men'},
-                      'Nagoya protocol restrictions and compliance conditions': {'FieldType': 'T',
-                                                                                 'Value': 'no '
-                                                                                          'known '
-                                                                                          'restrictions '
-                                                                                          'under '
-                                                                                          'the '
-                                                                                          'Nagoya '
-                                                                                          'protocol'},
-                      'Ontobiotope': {'FieldType': 'RLink', 'Value': 'OBT:000190'},
-                      'Organism type': {'FieldType': 'C',
-                                        'Value': [{'Name': 'Algae', 'Value': 'no'},
-                                                  {'Name': 'Archaea',
-                                                   'Value': 'yes'},
-                                                  {'Name': 'Bacteria',
-                                                   'Value': 'no'},
-                                                  {'Name': 'Cyanobacteria',
-                                                   'Value': 'no'},
-                                                  {'Name': 'Filamentous Fungi',
-                                                   'Value': 'no'},
-                                                  {'Name': 'Phage', 'Value': 'no'},
-                                                  {'Name': 'Plasmid',
-                                                   'Value': 'no'},
-                                                  {'Name': 'Virus', 'Value': 'no'},
-                                                  {'Name': 'Yeast',
-                                                   'Value': 'no'}]},
-                      'Other culture collection numbers': {'FieldType': 'E',
-                                                           'Value': 'aaa a; aaa3 '
-                                                                    'a3'},
-                      'Pathogenicity': {'FieldType': 'E', 'Value': 'illness'},
-                      'Plasmids': {'FieldType': 'E', 'Value': 'asda'},
-                      'Plasmids collections fields': {'FieldType': 'E',
-                                                      'Value': 'asdasda'},
-                      'Ploidy': {'FieldType': 'T', 'Value': 'Polyploid'},
-                      'Quarantine in Europe': {'FieldType': 'T', 'Value': 'no'},
-                      'Recommended growth temperature': {'FieldType': 'S',
-                                                         'MaxValue': 30.0,
-                                                         'MinValue': 30.0},
-                      'Remarks': {'FieldType': 'E', 'Value': 'no remarks for me'},
-                      'Restrictions on use': {'FieldType': 'T',
-                                              'Value': 'no restriction apply'},
-                      'Risk group': {'FieldType': 'T', 'Value': '1'},
-                      'Sexual state': {'FieldType': 'E', 'Value': 'MT+A'},
-                      'Status': {'FieldType': 'E',
-                                 'Value': 'type of Bacillus alcalophilus'},
-                      'Strain from a registered collection': {'FieldType': 'T',
-                                                              'Value': 'no'},
-                      'Substrate of isolation': {'FieldType': 'E',
-                                                 'Value': 'some substrate'},
-                      'Taxon name': {'FieldType': 'SynLink',
-                                     'Value': 'Escherichia coli'},
-                      'Tested temperature growth range': {'FieldType': 'S',
-                                                          'MaxValue': 32.0,
-                                                          'MinValue': 29.0}}}
-
-
-class StrainSerializerTest(unittest.TestCase):
-
-    def test_serialize_to_biolomics(self):
-        strain = create_full_data_strain()
-        ws_strain = strain_to_biolomics(strain, client=None)
-        self.assertDictEqual(ws_strain, STRAIN_WS_EXPECTED_NO_REMOTE)
-
-    def test_serialize_to_biolomics_remote(self):
-        client = BiolomicsMirriClient(SERVER_URL, VERSION, CLIENT_ID,
-                                      SECRET_ID, USERNAME, PASSWORD)
-        strain = create_full_data_strain()
-        marker = GenomicSequenceBiolomics()
-        marker.marker_id = "MUM 02.15 - Beta tubulin"
-        marker.marker_type = 'TUBB'
-        strain.genetics.markers = [marker]
-        ws_strain = strain_to_biolomics(strain, client=client)
-
-        self.assertEqual(strain.collect.habitat_ontobiotope,
-                         ws_strain['RecordDetails']['Ontobiotope']['Value'][0]['Name']['Value'])
-        self.assertEqual(pycountry.countries.get(alpha_3=strain.collect.location.country).name,
-                         ws_strain['RecordDetails']['Country']['Value'][0]['Name']['Value'])
-        self.assertEqual(strain.publications[0].title,
-                         ws_strain['RecordDetails']['Literature']['Value'][0]['Name']['Value'])
-        self.assertEqual(strain.genetics.markers[0].marker_id,
-                         ws_strain['RecordDetails']['Sequences TUB']['Value'][0]['Name']['Value'])
-
-    def test_serialize_from_biolomics(self):
-        ws_strain = STRAIN_WS
-        strain = strain_from_biolomics(ws_strain)
-        self.assertEqual(strain.record_id, 148038)
-        self.assertEqual(strain.record_name, 'MIRRI 2240561')
-        self.assertEqual(strain.taxonomy.long_name, 'Escherichia coli')
-        self.assertEqual(strain.growth.recommended_media, ['AAA'])
-        self.assertEqual(strain.collect.location.altitude, 121)
-        self.assertEqual(strain.collect.location.country, 'ESP')
-        self.assertEqual(strain.applications, 'health')
-        self.assertEqual(strain.id.strain_id, 'TESTCC 1')
-        self.assertEqual(strain.collect.date.strfdate, '19910101')
-        self.assertEqual(strain.taxonomy.comments, 'lalalalla')
-        self.assertEqual(strain.catalog_inclusion_date.strfdate, '19850502')
-        self.assertIn('NCTC, National Collection of Type ', strain.deposit.who)
-        self.assertTrue(strain.is_potentially_harmful)
-        self.assertEqual(strain.form_of_supply, ['Agar', 'Lyo'])
-        self.assertTrue(strain.genetics.gmo)
-        self.assertEqual(strain.genetics.gmo_construction, 'instructrion to build')
-        self.assertEqual(strain.genetics.genotype, 'some genotupe')
-        self.assertEqual(strain.history, ['newer', 'In the middle', 'older'])
-        self.assertEqual(strain.taxonomy.infrasubspecific_name, 'serovar tete')
-        self.assertEqual(strain.isolation.who, 'the isolator')
-        self.assertEqual(strain.isolation.date.strfdate, '19000101')
-        self.assertEqual(strain.mta_files, ['https://example.com'])
-        self.assertEqual(strain.genetics.mutant_info, 'x-men')
-        self.assertEqual(strain.collect.habitat_ontobiotope, 'OBT:000190')
-        self.assertEqual(strain.taxonomy.organism_type[0].name, 'Archaea')
-        self.assertEqual(strain.other_numbers[0].strain_id, 'aaa a')
-        self.assertEqual(strain.other_numbers[1].strain_id, 'aaa3 a3')
-        self.assertEqual(strain.pathogenicity, 'illness')
-        self.assertEqual(strain.genetics.plasmids, ['asda'])
-        self.assertEqual(strain.genetics.ploidy, 9)
-        self.assertFalse(strain.is_subject_to_quarantine)
-        self.assertEqual(strain.risk_group, '1')
-        self.assertFalse(strain.is_from_registered_collection)
-        self.assertEqual(strain.growth.tested_temp_range, {'min': 29, 'max': 32})
-
-
-BIOLOMICSSEQ = {
-    'RecordDetails': {
-        'Barcode level': {'FieldType': 20, 'Value': 'undefined'},
-        'DNA extract number': {'FieldType': 5, 'Value': ''},
-        'DNA sequence': {'FieldType': 14,
-                         'Value': {'Sequence': 'caaaggaggccttctccctcttcgtaag'}},
-        'Editing state': {'FieldType': 20, 'Value': 'Auto import'},
-        'Forward primer(s)': {'FieldType': 5, 'Value': ''},
-        'Genbank': {'FieldType': 21, 'Value': []},
-        'INSDC number': {'FieldType': 5, 'Value': 'AATGAT'},
-        'Literature': {'FieldType': 21, 'Value': []},
-        'Literature1': {'FieldType': 118, 'Value': []},
-        'Marker name': {'FieldType': 5, 'Value': 'CaM'},
-        'Privacy': {'FieldType': 20, 'Value': 'undefined'},
-        'Quality': {'FieldType': 5, 'Value': ''},
-        'Remarks': {'FieldType': 5, 'Value': ''},
-        'Reverse primer(s)': {'FieldType': 5, 'Value': ''},
-        'Review state': {'FieldType': 5, 'Value': ''},
-        'Strain number': {'FieldType': 5, 'Value': 'MUM 02.54'}},
-    'RecordId': 101,
-    'RecordName': 'MUM 02.54 - CaM'}
-
-
-class SequenceSerializerTest(unittest.TestCase):
-
-    def test_from_biolomics(self):
-        marker = sequence_from_biolomics(BIOLOMICSSEQ)
-        self.assertEqual(marker.record_name, BIOLOMICSSEQ['RecordName'])
-        self.assertEqual(marker.record_id, BIOLOMICSSEQ['RecordId'])
-        self.assertEqual(marker.marker_type, BIOLOMICSSEQ['RecordDetails']['Marker name']['Value'])
-        self.assertEqual(marker.marker_id, BIOLOMICSSEQ['RecordDetails']['INSDC number']['Value'])
-        self.assertEqual(marker.marker_seq, BIOLOMICSSEQ['RecordDetails']['DNA sequence']['Value']['Sequence'])
-
-    def test_to_biolomics(self):
-        marker = GenomicSequenceBiolomics()
-        marker.marker_id = 'GGAAUUA'
-        marker.marker_seq = 'aattgacgat'
-        marker.marker_type = 'CaM'
-        marker.record_name = 'peioMarker'
-        marker.record_id = 111
-        ws_seq = sequence_to_biolomics(marker)
-        expected = {'RecordId': marker.record_id,
-                    'RecordName': marker.record_name,
-                    'RecordDetails': {
-                        'INSDC number': {'Value': marker.marker_id, 'FieldType': 'E'},
-                        'DNA sequence': {'Value': {'Sequence': marker.marker_seq}, 'FieldType': 'N'},
-                        'Marker name': {'Value': marker.marker_type, 'FieldType': 'E'}}}
-
-        self.assertEqual(ws_seq, expected)
-
-
-BIOLOMICS_MEDIUM = {
-    "RecordId": 100,
-    "RecordName": "MA20S",
-    "RecordDetails": {
-        "Full description": {
-            "Value": "mout agar+20% saccharose",
-            "FieldType": 5
-        },
-        "Ingredients": {
-            "Value": "Malt extract\r\n\tDilute brewery malt with water to 10% sugar solution (level 10 on Brix saccharose meter), 15 minutes at 121 C\r\nsaccharose\t200g\r\ndistilled water\t0.6l\r\nagar\t15g\r\n",
-            "FieldType": 5
-        },
-        "Link to full description": {
-            "Value": [],
-            "FieldType": 21
-        },
-        "Medium description": {
-            "Value": "",
-            "FieldType": 5
-        },
-        "Other name": {
-            "Value": "",
-            "FieldType": 5
-        },
-        "pH": {
-            "Value": "7 with KOH",
-            "FieldType": 5
-        },
-        "Remarks": {
-            "Value": "",
-            "FieldType": 5
-        },
-        "Reference": {
-            "Value": "",
-            "FieldType": 5
-        },
-        "Sterilization conditions": {
-            "Value": "15 minutes at 121 C",
-            "FieldType": 5
-        }
-    }
-}
-
-
-class MediumSerializerTest(unittest.TestCase):
-    def test_from_biolomics(self):
-        medium = growth_medium_from_biolomics(BIOLOMICS_MEDIUM)
-        self.assertEqual(medium.record_id, BIOLOMICS_MEDIUM['RecordId'])
-        self.assertEqual(medium.record_name, BIOLOMICS_MEDIUM['RecordName'])
-        self.assertEqual(medium.ingredients, BIOLOMICS_MEDIUM['RecordDetails']['Ingredients']['Value'])
-        self.assertEqual(medium.full_description, BIOLOMICS_MEDIUM['RecordDetails']['Full description']['Value'])
-        self.assertEqual(medium.ph, BIOLOMICS_MEDIUM['RecordDetails']['pH']['Value'])
-
-
-BIOLOMICS_BIBLIOGRAPHY = {
-    "RecordId": 100,
-    "RecordName": "Miscellaneous notes on Mucoraceae",
-    "RecordDetails": {
-        "Associated strains": {
-            "Value": [],
-            "FieldType": 118
-        },
-        "Associated taxa": {
-            "Value": [],
-            "FieldType": 118
-        },
-        "Authors": {
-            "Value": "Schipper, M.A.A.; Samson, R.A.",
-            "FieldType": 5
-        },
-        "Associated sequences": {
-            "Value": [],
-            "FieldType": 118
-        },
-        "Abstract": {
-            "Value": "",
-            "FieldType": 5
-        },
-        "Collection": {
-            "Value": "",
-            "FieldType": 5
-        },
-        "DOI number": {
-            "Value": "",
-            "FieldType": 5
-        },
-        "Editor(s)": {
-            "Value": "",
-            "FieldType": 5
-        },
-        "Full reference": {
-            "Value": "",
-            "FieldType": 5
-        },
-        "Hyperlink": {
-            "Value": [],
-            "FieldType": 21
-        },
-        "ISBN": {
-            "Value": "",
-            "FieldType": 5
-        },
-        "ISSN": {
-            "Value": "",
-            "FieldType": 5
-        },
-        "Issue": {
-            "Value": "",
-            "FieldType": 5
-        },
-        "Journal": {
-            "Value": "Mycotaxon",
-            "FieldType": 5
-        },
-        "Journal-Book": {
-            "Value": "",
-            "FieldType": 5
-        },
-        "Keywords": {
-            "Value": "",
-            "FieldType": 5
-        },
-        "Page from": {
-            "Value": "475",
-            "FieldType": 5
-        },
-        "Page to": {
-            "Value": "491",
-            "FieldType": 5
-        },
-        "Publisher": {
-            "Value": "",
-            "FieldType": 5
-        },
-        "PubMed ID": {
-            "Value": "",
-            "FieldType": 5
-        },
-        "Volume": {
-            "Value": "50",
-            "FieldType": 5
-        },
-        "Year": {
-            "Value": 1994,
-            "FieldType": 4
-        }
-    }
-}
-
-
-class BibliographySerializerTest(unittest.TestCase):
-    def test_from_biolomics(self):
-        pub = literature_from_biolomics(BIOLOMICS_BIBLIOGRAPHY)
-        self.assertEqual(pub.record_name, "Miscellaneous notes on Mucoraceae")
-        self.assertEqual(pub.record_id, 100)
-        self.assertEqual(pub.year, 1994)
-        self.assertEqual(pub.authors, "Schipper, M.A.A.; Samson, R.A.")
-
-    def test_to_biolomics(self):
-        pub = Publication()
-        pub.title = 'My title'
-        pub.year = 1992
-        pub.authors = 'me and myself'
-        pub.pubmed_id = '1112222'
-        pub.issue = 'issue'
-        ws_data = literature_to_biolomics(pub)
-        expected = {
-            'RecordDetails': {
-                'Authors': {'FieldType': 'E', 'Value': 'me and myself'},
-                'PubMed ID': {'FieldType': 'E', 'Value': '1112222'},
-                'Issue': {'FieldType': 'E', 'Value': 'issue'},
-                'Year': {'FieldType': 'D', 'Value': 1992}},
-            'RecordName': 'My title'}
-        self.assertDictEqual(expected, ws_data)
-
-    def test_to_biolomics2(self):
-        pub = Publication()
-        pub.pubmed_id = '1112222'
-        ws_data = literature_to_biolomics(pub)
-        expected = {
-            'RecordDetails': {
-                'PubMed ID': {'FieldType': 'E', 'Value': '1112222'}},
-            'RecordName': f'PUBMED:{pub.pubmed_id}'}
-        self.assertDictEqual(expected, ws_data)
-
-        pub = Publication()
-        pub.doi = 'doi.er/111/12131'
-        ws_data = literature_to_biolomics(pub)
-        expected = {
-            'RecordDetails': {
-                'DOI number': {'FieldType': 'E', 'Value': pub.doi}},
-            'RecordName': f'DOI:{pub.doi}'}
-        self.assertDictEqual(expected, ws_data)
-
-
-if __name__ == "__main__":
-    import sys;
-    sys.argv = ['', 'BibliographySerializerTest']
-    unittest.main()

tests/biolomics/test_strain_operations.py

@@ -1,156 +0,0 @@
-import unittest
-
-from mirri.biolomics.remote.endoint_names import STRAIN_WS
-from .utils import VERSION, SERVER_URL, create_full_data_strain
-from mirri.biolomics.settings import CLIENT_ID, SECRET_ID, USERNAME, PASSWORD
-from mirri.biolomics.remote.biolomics_client import BiolomicsMirriClient
-from mirri.biolomics.pipelines.strain import retrieve_strain_by_accession_number
-
-
-class BiolomicsStrainClientTest(unittest.TestCase):
-    def setUp(self):
-        self.client = BiolomicsMirriClient(SERVER_URL, VERSION, CLIENT_ID,
-                                           SECRET_ID, USERNAME, PASSWORD)
-
-    def test_retrieve_strain_by_id(self):
-        record_id = 14803
-        strain = self.client.retrieve_by_id(STRAIN_WS, record_id)
-        self.assertEqual(strain.record_id, record_id)
-        print(strain.record_name)
-
-    def test_retrieve_strain_by_name(self):
-        record_id = 14803
-        record_name = 'MIRRI0014803'
-        strain = self.client.retrieve_by_name(STRAIN_WS, record_name)
-        self.assertEqual(strain.record_name, record_name)
-        self.assertEqual(strain.record_id, record_id)
-
-    def test_search_strain(self):
-        accession_number = "BEA 0014B"
-        query = {"Query": [{"Index": 0,
-                            "FieldName": "Collection accession number",
-                            "Operation": "TextExactMatch",
-                            "Value": accession_number}],
-                 "Expression": "Q0",
-                 "DisplayStart": 0,
-                 "DisplayLength": 10}
-
-        search_response = self.client.search(STRAIN_WS, query)
-
-        self.assertEqual(search_response['total'], 1)
-        self.assertEqual(search_response['records'][0].id.strain_id,
-                         accession_number)
-
-    def test_search_strain4(self):
-        accession_number = "TESTCC 1"
-        query = {"Query": [{"Index": 0,
-                            "FieldName": "Collection accession number",
-                            "Operation": "TextExactMatch",
-                            "Value": accession_number}],
-                 "Expression": "Q0",
-                 "DisplayStart": 0,
-                 "DisplayLength": 10}
-
-        search_response = self.client.search(STRAIN_WS, query)
-        for strain in search_response['records']:
-            print(strain)
-            self.client.delete_by_id(STRAIN_WS, strain.record_id)
-
-    def test_search_strain_no_found(self):
-        accession_number = "BEA 0014B_"
-        query = {"Query": [{"Index": 0,
-                            "FieldName": "Collection accession number",
-                            "Operation": "TextExactMatch",
-                            "Value": accession_number}],
-                 "Expression": "Q0",
-                 "DisplayStart": 0,
-                 "DisplayLength": 10}
-
-        search_response = self.client.search(STRAIN_WS, query)
-
-        self.assertEqual(search_response['total'], 0)
-        self.assertFalse(search_response['records'])
-
-    def test_create_strain(self):
-        strain = create_full_data_strain()
-        strain.taxonomy.interspecific_hybrid = None
-        record_id = None
-        try:
-            new_strain = self.client.create(STRAIN_WS, strain)
-            record_id = new_strain.record_id
-            self.assertIsNone(new_strain.taxonomy.interspecific_hybrid)
-            self.assertEqual(new_strain.growth.recommended_media, ['AAA'])
-            self.assertEqual(new_strain.id.strain_id, strain.id.strain_id)
-        finally:
-            if record_id is not None:
-                self.client.delete_by_id(STRAIN_WS, record_id)
-
-    def test_update_strain(self):
-        strain = create_full_data_strain()
-        record_id = None
-        try:
-            new_strain = self.client.create(STRAIN_WS, strain)
-            record_id = new_strain.record_id
-            self.assertEqual(new_strain.id.strain_id, strain.id.strain_id)
-            self.assertFalse(new_strain.taxonomy.interspecific_hybrid)
-            new_strain.id.number = '2'
-            new_strain.taxonomy.interspecific_hybrid = None
-            updated_strain = self.client.update(STRAIN_WS, new_strain)
-            self.assertEqual(updated_strain.id.strain_id, new_strain.id.strain_id)
-            self.assertIsNone(updated_strain.taxonomy.interspecific_hybrid)
-
-            retrieved_strain = self.client.retrieve_by_id(STRAIN_WS, record_id)
-            self.assertEqual(retrieved_strain.id.strain_id, new_strain.id.strain_id)
-            self.assertIsNone(retrieved_strain.taxonomy.interspecific_hybrid)
-        finally:
-            if record_id is not None:
-                print('deleting')
-                self.client.delete_by_id(STRAIN_WS, record_id)
-
-    def test_update_strain_pathogenicity(self):
-        strain = create_full_data_strain()
-        print(strain.pathogenicity)
-        record_id = None
-        try:
-            new_strain = self.client.create(STRAIN_WS, strain)
-            record_id = new_strain.record_id
-            self.assertEqual(new_strain.id.strain_id, strain.id.strain_id)
-            self.assertEqual(new_strain.pathogenicity, 'illness')
-
-            new_strain.pathogenicity = None
-            updated_strain = self.client.update(STRAIN_WS, new_strain)
-            self.assertEqual(updated_strain.id.strain_id, new_strain.id.strain_id)
-            self.assertIsNone(updated_strain.pathogenicity)
-
-            retrieved_strain = self.client.retrieve_by_id(STRAIN_WS, record_id)
-            self.assertEqual(retrieved_strain.id.strain_id, new_strain.id.strain_id)
-            self.assertIsNone(retrieved_strain.pathogenicity)
-        finally:
-            if record_id is not None:
-                self.client.delete_by_id(STRAIN_WS, record_id)
-
-    def test_search_by_accession_number(self):
-        accession_number = "BEA 0014B"
-        strain = retrieve_strain_by_accession_number(self.client, accession_number)
-        self.assertEqual(strain.id.strain_id, accession_number)
-
-    def test_search_by_accession_number(self):
-        accession_number = "BEA 0014B_"
-        strain = retrieve_strain_by_accession_number(self.client, accession_number)
-        self.assertFalse(strain)
-
-
-class BiolomicsClientGrowthMediaTest(unittest.TestCase):
-    def setUp(self):
-        self.client = BiolomicsMirriClient(SERVER_URL, VERSION, CLIENT_ID,
-                                           SECRET_ID, USERNAME, PASSWORD)
-
-    def xtest_growth_media_by_name(self):
-        gm = self.client.retrieve('growth_media', 'AAA')
-        self.assertEqual(gm['Record Id'], 1)
-
-
-if __name__ == "__main__":
-    # import sys;sys.argv = ['',
-    #                        'BiolomicsWriter.test_mirri_excel_parser_invalid']
-    unittest.main()

tests/biolomics/utils.py

@@ -1,99 +0,0 @@
-from mirri.biolomics.serializers.strain import StrainMirri
-from mirri.entities.strain import StrainId, OrganismType
-from mirri.entities.sequence import GenomicSequence
-from mirri.entities.date_range import DateRange
-from mirri.entities.publication import Publication
-from mirri.settings import NAGOYA_NO_RESTRICTIONS
-
-VERSION = 'v2'
-SERVER_URL = 'https://webservices.bio-aware.com/mirri_test'
-
-
-def create_full_data_strain():
-    strain = StrainMirri()
-
-    strain.id.number = "1"
-    strain.id.collection = "TESTCC"
-    strain.id.url = "https://cect/2342"
-
-    strain.restriction_on_use = "no_restriction"
-    strain.nagoya_protocol = NAGOYA_NO_RESTRICTIONS
-    strain.abs_related_files = ['https://example.com']
-    strain.mta_files = ['https://example.com']
-    strain.other_numbers.append(StrainId(collection="aaa", number="a"))
-    strain.other_numbers.append(StrainId(collection="aaa3", number="a3"))
-    strain.is_from_registered_collection = False
-    strain.risk_group = '1'
-    strain.is_potentially_harmful = True
-    strain.is_subject_to_quarantine = False
-
-    strain.taxonomy.organism_type = [OrganismType(2)]
-    strain.taxonomy.genus = 'Escherichia'
-    strain.taxonomy.species = 'coli'
-    strain.taxonomy.interspecific_hybrid = False
-    strain.taxonomy.infrasubspecific_name = 'serovar tete'
-    strain.taxonomy.comments = 'lalalalla'
-
-    strain.status = "type of Bacillus alcalophilus"
-    strain.history = 'firstplave < seconn place < third place'
-
-    strain.deposit.who = "NCTC, National Collection of Type Cultures - NCTC, London, United Kingdom of Great Britain and Northern Ireland."
-    strain.deposit.date = DateRange(year=1985, month=5, day=2)
-    strain.catalog_inclusion_date = DateRange(year=1985, month=5, day=2)
-
-    strain.collect.location.country = "ESP"
-    strain.collect.location.state = "una state"
-    strain.collect.location.municipality = "one municipality"
-    strain.collect.location.longitude = 23.3
-    strain.collect.location.latitude = 23.3
-    strain.collect.location.altitude = 121
-    strain.collect.location.site = "somewhere in the world"
-    strain.collect.habitat_ontobiotope = "OBT:000190"
-    strain.collect.habitat = 'some habitat'
-    strain.collect.who = "the collector"
-    strain.collect.date = DateRange(year=1991)
-
-    strain.isolation.date = DateRange(year=1900)
-    strain.isolation.who = 'the isolator'
-    strain.isolation.substrate_host_of_isolation = 'some substrate'
-
-    # already existing media in test_mirri
-
-    strain.growth.recommended_temp = {'min': 30, 'max': 30}
-    strain.growth.recommended_media = ["AAA"]
-    strain.growth.tested_temp_range = {'min': 29, 'max': 32}
-
-    strain.form_of_supply = ["Agar", "Lyo"]
-
-    #strain.other_denominations = ["lajdflasjdldj"]
-
-    gen_seq = GenomicSequence()
-    gen_seq.marker_id = "pepe"
-    gen_seq.marker_type = "16S rRNA"
-    strain.genetics.markers.append(gen_seq)
-    strain.genetics.ploidy = 9
-    strain.genetics.genotype = 'some genotupe'
-    strain.genetics.gmo = True
-    strain.genetics.gmo_construction = 'instructrion to build'
-    strain.genetics.mutant_info = 'x-men'
-    strain.genetics.sexual_state = 'MT+A'
-    strain.genetics.plasmids = ['asda']
-    strain.genetics.plasmids_in_collections = ['asdasda']
-
-    pub = Publication()
-    pub.title = "The genus Amylomyces"
-    strain.publications = [pub]
-
-    strain.plant_pathogenicity_code = 'PATH:001'
-    strain.pathogenicity = 'illness'
-    strain.enzyme_production = 'some enzimes'
-    strain.production_of_metabolites = 'big factory of cheese'
-    strain.applications = 'health'
-
-    strain.remarks = 'no remarks for me'
-    return strain
-
-
-if __name__ == '__main__':
-    strain = create_full_data_strain()
-    print(strain.collect.habitat_ontobiotope)

tests/data/invalid_excel.mirri.json

@@ -1,5 +0,0 @@
-{
-    "key1": "value1",
-    "key2": "value2",
-    "key3": "value3"
-}

tests/test_entities.py

@@ -1,318 +0,0 @@
-"""
-Created on 2020(e)ko abe. 2(a)
-
-@author: peio
-"""
-
-import unittest
-
-from mirri.entities.publication import Publication
-from mirri.entities.date_range import DateRange
-from mirri.entities.location import Location
-from mirri.entities.sequence import GenomicSequence
-from mirri.entities.strain import (
-    Collect,
-    Deposit,
-    Isolation,
-    ValidationError,
-    OrganismType,
-    Strain,
-    StrainId,
-    Taxonomy,
-)
-from mirri.settings import (
-    COLLECT,
-    COUNTRY,
-    DATE_OF_ISOLATION,
-    DEPOSIT,
-    DEPOSITOR,
-    GENETICS,
-    GROWTH,
-    ISOLATED_BY,
-    ISOLATION,
-    LOCATION,
-    MARKERS,
-    NAGOYA_DOCS_AVAILABLE,
-    NAGOYA_PROTOCOL,
-    ORGANISM_TYPE,
-    OTHER_CULTURE_NUMBERS,
-    PLOIDY,
-    RECOMMENDED_GROWTH_MEDIUM,
-    TAXONOMY,
-    DATE_OF_INCLUSION, NO_RESTRICTION
-)
-from mirri.validation.entity_validators import validate_strain
-
-
-class TestDataRange(unittest.TestCase):
-    def test_data_range_init(self):
-        dr = DateRange()
-
-        self.assertFalse(dr)
-
-        self.assertEqual(dr.__str__(), "")
-        self.assertEqual(dr.range["start"], None)
-        self.assertEqual(dr.range["end"], None)
-
-        dr.strpdate("2012")
-        self.assertEqual(dr.strfdate, "2012----")
-        self.assertTrue(dr)
-
-        dr.strpdate("2012----")
-        self.assertEqual(dr.strfdate, "2012----")
-
-        dr.strpdate("201212--")
-        self.assertEqual(dr.strfdate, "201212--")
-        try:
-            dr.strpdate("201213--")
-            self.fail()
-        except ValueError:
-            pass
-
-        try:
-            dr = DateRange(year=2012, month=13)
-            self.fail()
-        except ValueError:
-            pass
-
-        dr = DateRange(year=2020)
-        self.assertEqual(dr.strfdate, "2020----")
-
-        dr2 = dr.strpdate("2012")
-        self.assertEqual(dr2.range["start"].year, 2012)
-        self.assertEqual(dr2.range["start"].month, 1)
-        self.assertEqual(dr2.range["start"].day, 1)
-
-        self.assertEqual(dr2.range["end"].year, 2012)
-        self.assertEqual(dr2.range["end"].month, 12)
-        self.assertEqual(dr2.range["end"].day, 31)
-
-
-class TestCollect(unittest.TestCase):
-    def test_collect_basic(self):
-        collect = Collect()
-        self.assertEqual(collect.dict(), {})
-
-        collect.location.country = "ESP"
-        collect.date = DateRange().strpdate("2012----")
-
-        collect.who = "pepito"
-        self.assertEqual(
-            dict(collect.dict()),
-            {
-                "location": {"countryOfOriginCode": "ESP"},
-                "collected_by": "pepito",
-                "date_of_collection": "2012----",
-            },
-        )
-        self.assertEqual(collect.__str__(),
-                         "Collected: Spain in 2012---- by pepito")
-
-
-class TestOrganismType(unittest.TestCase):
-    def test_basic_usage(self):
-        org_type = OrganismType(2)
-        self.assertEqual(org_type.name, "Archaea")
-        self.assertEqual(org_type.code, 2)
-        try:
-            org_type.ko = 'a'
-            self.fail()
-        except TypeError:
-            pass
-
-        org_type = OrganismType("Archaea")
-
-
-class TestTaxonomy(unittest.TestCase):
-    def test_taxonomy_basic(self):
-        taxonomy = Taxonomy()
-        self.assertEqual(taxonomy.dict(), {})
-        self.assertFalse(taxonomy)
-
-    def test_taxonomy_with_data(self):
-        taxonomy = Taxonomy()
-        taxonomy.genus = "Bacilus"
-        taxonomy.organism_type = [OrganismType("Archaea")]
-        taxonomy.species = "vulgaris"
-        self.assertEqual(taxonomy.long_name, "Bacilus vulgaris")
-
-        # print(taxonomy.dict())
-
-
-class TestLocation(unittest.TestCase):
-    def test_empty_init(self):
-        loc = Location()
-        self.assertEqual(loc.dict(), {})
-        self.assertFalse(loc)
-
-    def test_add_data(self):
-        loc = Location()
-        loc.country = "esp"
-        self.assertEqual(loc.dict(), {COUNTRY: "esp"})
-        loc.state = None
-        self.assertEqual(loc.dict(), {COUNTRY: "esp"})
-
-
-class TestStrain(unittest.TestCase):
-    def test_empty_strain(self):
-        strain = Strain()
-        self.assertEqual(strain.dict(), {})
-
-    def test_strain_add_data(self):
-        strain = Strain()
-
-        strain.id.number = "5433"
-        strain.id.collection = "CECT"
-        strain.id.url = "https://cect/2342"
-
-        try:
-            strain.nagoya_protocol = "asdas"
-            self.fail()
-        except ValidationError:
-            pass
-
-        strain.nagoya_protocol = NAGOYA_DOCS_AVAILABLE
-        strain.dict()[NAGOYA_PROTOCOL] = NAGOYA_DOCS_AVAILABLE
-
-        strain.collect.location.country = "ESP"
-
-        self.assertEqual(strain.dict()[COLLECT][LOCATION][COUNTRY], "ESP")
-
-        strain.genetics.ploidy = 9
-        self.assertEqual(strain.dict()[GENETICS][PLOIDY], 9)
-
-        strain.growth.recommended_media = ["asd"]
-        strain.isolation.date = DateRange(year=1900)
-        self.assertEqual(strain.dict()[ISOLATION]
-                         [DATE_OF_ISOLATION], "1900----")
-
-        strain.deposit.who = "pepe"
-        self.assertEqual(strain.dict()[DEPOSIT][DEPOSITOR], "pepe")
-
-        strain.growth.recommended_media = ["11"]
-        self.assertEqual(strain.dict()[GROWTH]
-                         [RECOMMENDED_GROWTH_MEDIUM], ["11"])
-
-        strain.taxonomy.organism_type = [OrganismType(2)]
-        self.assertEqual(
-            strain.dict()[TAXONOMY][ORGANISM_TYPE], [
-                {"code": 2, "name": "Archaea"}]
-        )
-
-        strain.taxonomy.organism_type = [OrganismType("Algae")]
-        self.assertEqual(
-            strain.dict()[TAXONOMY][ORGANISM_TYPE], [
-                {"code": 1, "name": "Algae"}]
-        )
-
-        strain.other_numbers.append(StrainId(collection="aaa", number="a"))
-        strain.other_numbers.append(StrainId(collection="aaa3", number="a3"))
-        self.assertEqual(
-            strain.dict()[OTHER_CULTURE_NUMBERS],
-            [
-                {"collection_code": "aaa", "accession_number": "a"},
-                {"collection_code": "aaa3", "accession_number": "a3"},
-            ],
-        )
-        strain.form_of_supply = ["Agar", "Lyo"]
-        gen_seq = GenomicSequence()
-        self.assertEqual(gen_seq.dict(), {})
-        gen_seq.marker_id = "pepe"
-        gen_seq.marker_type = "16S rRNA"
-        strain.genetics.markers.append(gen_seq)
-        self.assertEqual(
-            strain.dict()[GENETICS][MARKERS],
-            [{"marker_type": "16S rRNA", "INSDC": "pepe"}],
-        )
-
-        strain.collect.habitat_ontobiotope = "OBT:111111"
-        self.assertEqual(strain.collect.habitat_ontobiotope, "OBT:111111")
-
-        try:
-            strain.collect.habitat_ontobiotope = "OBT:11111"
-            self.fail()
-        except ValidationError:
-            pass
-
-        # publications
-        try:
-            strain.publications = 1
-            self.fail()
-        except ValidationError:
-            pass
-        pub = Publication()
-        pub.id = "1"
-        try:
-            strain.publications = pub
-            self.fail()
-        except ValidationError:
-            pass
-
-        strain.publications = [pub]
-        self.assertEqual(strain.publications[0].id, "1")
-
-        strain.catalog_inclusion_date = DateRange(year=1992)
-        self.assertEqual(strain.dict()[DATE_OF_INCLUSION], '1992----')
-
-        import pprint
-
-        pprint.pprint(strain.dict())
-
-    def test_strain_validation(self):
-        strain = Strain()
-        strain.form_of_supply = ['Lyo']
-
-        return
-
-        errors = validate_strain(strain)
-        self.assertEqual(len(errors), 10)
-
-        strain.id.collection = 'test'
-        strain.id.number = '1'
-
-
-        errors = validate_strain(strain)
-        self.assertEqual(len(errors), 9)
-
-        strain.nagoya_protocol = NAGOYA_DOCS_AVAILABLE
-        strain.restriction_on_use = NO_RESTRICTION
-        strain.risk_group = 1
-        strain.taxonomy.organism_type = [OrganismType(4)]
-        strain.taxonomy.hybrids = ['Sac lac', 'Sac lcac3']
-        strain.growth.recommended_media = ['aa']
-        strain.growth.recommended_temp = {'min': 2, 'max':5}
-        strain.form_of_supply = ['lyo']
-        strain.collect.location.country = 'ESP'
-        errors = validate_strain(strain)
-        self.assertFalse(errors)
-
-
-class TestIsolation(unittest.TestCase):
-    def test_iniatialize_isollation(self):
-        isolation = Isolation()
-        self.assertEqual(isolation.dict(), {})
-        isolation.who = "pepito"
-        self.assertTrue(ISOLATED_BY in isolation.dict())
-        isolation.date = DateRange().strpdate("2012----")
-        self.assertTrue(DATE_OF_ISOLATION in isolation.dict())
-
-        try:
-            isolation.location.site = "spain"
-            self.fail()
-        except (ValueError, AttributeError):
-            pass
-
-
-class TestGenomicSequence(unittest.TestCase):
-    def test_empty_init(self):
-        gen_seq = GenomicSequence()
-        self.assertEqual(gen_seq.dict(), {})
-        gen_seq.marker_id = "pepe"
-        gen_seq.marker_type = "16S rRNA"
-        self.assertEqual(gen_seq.dict(), {
-                         "marker_type": "16S rRNA", "INSDC": "pepe"})
-
-
-if __name__ == "__main__":
-    # import sys;sys.argv = ['', 'TestStrain']
-    unittest.main()

tests/test_parsers.py

@@ -1,51 +0,0 @@
-from mirri.entities.strain import ValidationError
-import unittest
-from pathlib import Path
-from pprint import pprint
-from mirri.io.parsers.mirri_excel import parse_mirri_excel
-
-TEST_DATA_DIR = Path(__file__).parent / "data"
-
-
-class MirriExcelTests(unittest.TestCase):
-
-    def test_mirri_excel_parser(self):
-        in_path = TEST_DATA_DIR / "valid.mirri.xlsx"
-        with in_path.open("rb") as fhand:
-            parsed_data = parse_mirri_excel(fhand, version="20200601")
-
-        medium = parsed_data["growth_media"][0]
-        self.assertEqual("1", medium.acronym)
-        self.assertEqual(medium.description, "NUTRIENT BROTH/AGAR I")
-
-        strains = list(parsed_data["strains"])
-        strain = strains[0]
-        self.assertEqual(strain.publications[0].id, 1)
-        self.assertEqual(strain.publications[0].title, 'Cosa')
-        self.assertEqual(strain.id.number, "1")
-        pprint(strain.dict())
-
-    def xtest_mirri_excel_parser_invalid_fail(self):
-        in_path = TEST_DATA_DIR / "invalid.mirri.xlsx"
-        with in_path.open("rb") as fhand:
-            try:
-                parse_mirri_excel(fhand, version="20200601")
-                self.fail()
-            except ValidationError:
-                pass
-
-    def xtest_mirri_excel_parser_invalid(self):
-        in_path = TEST_DATA_DIR / "invalid.mirri.xlsx"
-        with in_path.open("rb") as fhand:
-            parsed_data = parse_mirri_excel(
-                fhand, version="20200601")
-
-        errors = parsed_data["errors"]
-        for _id, _errors in errors.items():
-            print(_id, _errors)
-
-
-if __name__ == "__main__":
-    # import sys;sys.argv = ['',
-    #                        'MirriExcelTests.test_mirri_excel_parser_invalid']
-    unittest.main()

tests/test_validation.py

@@ -1,589 +0,0 @@
-from datetime import datetime
-import unittest
-from pathlib import Path
-from itertools import chain
-
-from mirri.validation.tags import (
-    CHOICES,
-    COORDINATES,
-    CROSSREF,
-    CROSSREF_NAME,
-    DATE,
-    MATCH,
-    MISSING,
-    MULTIPLE,
-    NUMBER,
-    REGEXP,
-    SEPARATOR,
-    TAXON,
-    TYPE,
-    UNIQUE,
-    VALUES
-)
-
-from mirri.validation.excel_validator import (
-    is_valid_choices,
-    is_valid_coords,
-    is_valid_crossrefs,
-    is_valid_date,
-    is_valid_missing,
-    is_valid_number,
-    is_valid_regex,
-    is_valid_taxon,
-    is_valid_unique,
-    is_valid_file,
-    validate_mirri_excel,
-)
-
-
-TEST_DATA_DIR = Path(__file__).parent / "data"
-TS_VALUE = "value"
-TS_CONF = "conf"
-TS_ASSERT = "assert_func"
-
-
-class MirriExcelValidationTests(unittest.TestCase):
-
-    def test_validation_structure(self):
-        in_path = TEST_DATA_DIR / "invalid_structure.mirri.xlsx"
-        with in_path.open("rb") as fhand:
-            error_log = validate_mirri_excel(fhand)
-
-        entities = []
-        err_codes = []
-        for ett, errors in error_log.get_errors().items():
-            entities.append(ett)
-            err_codes.extend([err.code for err in errors])
-
-        self.assertIn("EFS", entities)
-        self.assertIn("STD", entities)
-        self.assertIn("GOD", entities)
-        self.assertIn("GMD", entities)
-
-        self.assertIn("EFS03", err_codes)
-        self.assertIn("EFS06", err_codes)
-        self.assertIn("EFS08", err_codes)
-        self.assertIn("GOD06", err_codes)
-        self.assertIn("GMD01", err_codes)
-        self.assertIn("STD05", err_codes)
-        self.assertIn("STD08", err_codes)
-        self.assertIn("STD12", err_codes)
-
-    def test_validation_content(self):
-        in_path = TEST_DATA_DIR / "invalid_content.mirri.xlsx"
-        with in_path.open("rb") as fhand:
-            error_log = validate_mirri_excel(fhand)
-
-        entities = []
-        err_codes = []
-        for ett, errors in error_log.get_errors().items():
-            entities.append(ett)
-            err_codes.extend([err.code for err in errors])
-
-        self.assertTrue(len(err_codes) > 0)
-
-        self.assertNotIn("EFS", entities)
-        self.assertIn("STD", entities)
-        self.assertIn("GOD", entities)
-        self.assertIn("GID", entities)
-
-        self.assertIn("GOD04", err_codes)
-        self.assertIn("GOD07", err_codes)
-        self.assertIn("GID03", err_codes)
-        self.assertIn("STD11", err_codes)
-        self.assertIn("STD15", err_codes)
-        self.assertIn("STD22", err_codes)
-        self.assertIn("STD04", err_codes)
-        self.assertIn("STD10", err_codes)
-        self.assertIn("STD07", err_codes)
-        self.assertIn("STD14", err_codes)
-        self.assertIn("STD16", err_codes)
-
-    def test_validation_valid(self):
-        in_path = TEST_DATA_DIR / "valid.mirri.xlsx"
-        with in_path.open("rb") as fhand:
-            error_log = validate_mirri_excel(fhand)
-
-        self.assertTrue(len(error_log.get_errors()) == 0)
-
-
-class ValidatoionFunctionsTest(unittest.TestCase):
-
-    def test_is_valid_regex(self):
-        tests = [
-            {
-                TS_VALUE: "abcDEF",
-                TS_CONF: {TYPE: REGEXP, MATCH: r"[a-zA-Z]+"},
-                TS_ASSERT: self.assertTrue
-            },
-            {
-                TS_VALUE: "123456",
-                TS_CONF: {TYPE: REGEXP, MATCH: r"[a-zA-Z]+"},
-                TS_ASSERT: self.assertFalse
-            },
-            {
-                TS_VALUE: "123456",
-                TS_CONF: {TYPE: REGEXP, MATCH: r"\d+"},
-                TS_ASSERT: self.assertTrue
-            },
-            {
-                TS_VALUE: "abcdef",
-                TS_CONF: {TYPE: REGEXP, MATCH: r"\d+"},
-                TS_ASSERT: self.assertFalse
-            },
-            {
-                TS_VALUE: "abc 123",
-                TS_CONF: {TYPE: REGEXP, MATCH: r"\w+(\s\w+)*$"},
-                TS_ASSERT: self.assertTrue
-            },
-            {
-                TS_VALUE: "123 abc",
-                TS_CONF: {TYPE: REGEXP, MATCH: r"\w+(\s\w+)*$"},
-                TS_ASSERT: self.assertTrue
-            },
-            {
-                TS_VALUE: "123      ",
-                TS_CONF: {TYPE: REGEXP, MATCH: r"\w+(\s\w+)*$"},
-                TS_ASSERT: self.assertFalse
-            },
-        ]
-
-        for test in tests:
-            value = test[TS_VALUE]
-            conf = test[TS_CONF]
-            assert_func = test[TS_ASSERT]
-            with self.subTest(value=value):
-                assert_func(is_valid_regex(value, conf))
-
-    def test_is_valid_choices(self):
-        tests = [
-            {
-                TS_VALUE: "1",
-                TS_CONF: {TYPE: CHOICES, VALUES: ["1", "2", "3", "4"]},
-                TS_ASSERT: self.assertTrue
-            },
-            {
-                TS_VALUE: "1, 3",
-                TS_CONF: {
-                    TYPE: CHOICES,
-                    VALUES: ["1", "2", "3", "4"],
-                    MULTIPLE: True,
-                    SEPARATOR: ","
-                },
-                TS_ASSERT: self.assertTrue
-            },
-            {
-                TS_VALUE: "5",
-                TS_CONF: {TYPE: CHOICES, VALUES: ["1", "2", "3", "4"]},
-                TS_ASSERT: self.assertFalse
-            },
-        ]
-
-        for test in tests:
-            value = test[TS_VALUE]
-            conf = test[TS_CONF]
-            assert_func = test[TS_ASSERT]
-            with self.subTest(value=value):
-                assert_func(is_valid_choices(value, conf))
-
-    def test_is_valid_crossref(self):
-        tests = [
-            {
-                TS_VALUE: "abc",
-                TS_CONF: {
-                    TYPE: CROSSREF,
-                    CROSSREF_NAME: "values",
-                    "crossrefs_pointer": {"values": ["abc", "def", "ghi"]},
-                },
-                TS_ASSERT: self.assertTrue,
-            },
-            {
-                TS_VALUE: "123",
-                TS_CONF: {
-                    TYPE: CROSSREF,
-                    CROSSREF_NAME: "values",
-                    "crossrefs_pointer": {"values": ["abc", "def", "ghi"]},
-                },
-                TS_ASSERT: self.assertFalse,
-            },
-            {
-                TS_VALUE: "abc, def",
-                TS_CONF: {
-                    TYPE: CROSSREF,
-                    CROSSREF_NAME: "values",
-                    "crossrefs_pointer": {"values": ["abc", "def", "ghi"]},
-                    MULTIPLE: True,
-                    SEPARATOR: ",",
-                },
-                TS_ASSERT: self.assertTrue,
-            },
-            {
-                TS_VALUE: "abc, 123",
-                TS_CONF: {
-                    TYPE: CROSSREF,
-                    CROSSREF_NAME: "values",
-                    "crossrefs_pointer": {"values": ["abc", "def", "ghi"]},
-                    MULTIPLE: True,
-                    SEPARATOR: ",",
-                },
-                TS_ASSERT: self.assertFalse,
-            },
-        ]
-
-        for test in tests:
-            value = test[TS_VALUE]
-            conf = test[TS_CONF]
-            assert_func = test[TS_ASSERT]
-            with self.subTest(value=value):
-                assert_func(is_valid_crossrefs(value, conf))
-
-    def test_is_valid_missing(self):
-        tests = [
-            {
-                TS_VALUE: 1,
-                TS_CONF: {TYPE: MISSING},
-                TS_ASSERT: self.assertTrue
-            },
-            {
-                TS_VALUE: "abc",
-                TS_CONF: {TYPE: MISSING},
-                TS_ASSERT: self.assertTrue
-            },
-            {
-                TS_VALUE: None,
-                TS_CONF: {TYPE: MISSING},
-                TS_ASSERT: self.assertFalse
-            },
-        ]
-
-        for test in tests:
-            value = test[TS_VALUE]
-            conf = test[TS_CONF]
-            assert_func = test[TS_ASSERT]
-            with self.subTest(value=value):
-                assert_func(is_valid_missing(value, conf))
-
-    def test_is_valid_date(self):
-        tests = [
-            {
-                TS_VALUE: '2020-04-07',
-                TS_CONF: {TYPE: DATE},
-                TS_ASSERT: self.assertTrue
-            },
-            {
-                TS_VALUE: '2020/04/07',
-                TS_CONF: {TYPE: DATE},
-                TS_ASSERT: self.assertTrue
-            },
-            {
-                TS_VALUE: datetime(2021, 5, 1),
-                TS_CONF: {TYPE: DATE},
-                TS_ASSERT: self.assertTrue
-            },
-            {
-                TS_VALUE: '2020-05',
-                TS_CONF: {TYPE: DATE},
-                TS_ASSERT: self.assertTrue
-            },
-            {
-                TS_VALUE: '2020/05',
-                TS_CONF: {TYPE: DATE},
-                TS_ASSERT: self.assertTrue
-            },
-            {
-                TS_VALUE: 2020,
-                TS_CONF: {TYPE: DATE},
-                TS_ASSERT: self.assertTrue
-            },
-            {
-                TS_VALUE: '2021 05 01',
-                TS_CONF: {TYPE: DATE},
-                TS_ASSERT: self.assertFalse
-            },
-            {
-                TS_VALUE: '04-07-2020',
-                TS_CONF: {TYPE: DATE},
-                TS_ASSERT: self.assertFalse
-            },
-            {
-                TS_VALUE: '2021-02-31',
-                TS_CONF: {TYPE: DATE},
-                TS_ASSERT: self.assertFalse
-            },
-            {
-                TS_VALUE: '2021-15',
-                TS_CONF: {TYPE: DATE},
-                TS_ASSERT: self.assertFalse
-            },
-            {
-                TS_VALUE: '15-2021',
-                TS_CONF: {TYPE: DATE},
-                TS_ASSERT: self.assertFalse
-            },
-            {
-                TS_VALUE: 3000,
-                TS_CONF: {TYPE: DATE},
-                TS_ASSERT: self.assertFalse
-            },
-            {
-                TS_VALUE: -2020,
-                TS_CONF: {TYPE: DATE},
-                TS_ASSERT: self.assertFalse
-            },
-        ]
-
-        for test in tests:
-            value = test[TS_VALUE]
-            conf = test[TS_CONF]
-            assert_func = test[TS_ASSERT]
-            with self.subTest(value=value):
-                assert_func(is_valid_date(value, conf))
-
-    def test_is_valid_coordinates(self):
-        tests = [
-            {
-                TS_VALUE: "23; 50",
-                TS_CONF: {TYPE: COORDINATES},
-                TS_ASSERT: self.assertTrue
-            },
-            {
-                TS_VALUE: "-90; -100",
-                TS_CONF: {TYPE: COORDINATES},
-                TS_ASSERT: self.assertTrue
-            },
-            {
-                TS_VALUE: "90; 100",
-                TS_CONF: {TYPE: COORDINATES},
-                TS_ASSERT: self.assertTrue
-            },
-            {
-                TS_VALUE: "0; 0",
-                TS_CONF: {TYPE: COORDINATES},
-                TS_ASSERT: self.assertTrue
-            },
-            {
-                TS_VALUE: "10; 20; 5",
-                TS_CONF: {TYPE: COORDINATES},
-                TS_ASSERT: self.assertTrue
-            },
-            {
-                TS_VALUE: "10; 20; -5",
-                TS_CONF: {TYPE: COORDINATES},
-                TS_ASSERT: self.assertTrue
-            },
-            {
-                TS_VALUE: "91; 50",
-                TS_CONF: {TYPE: COORDINATES},
-                TS_ASSERT: self.assertFalse
-            },
-            {
-                TS_VALUE: "87; 182",
-                TS_CONF: {TYPE: COORDINATES},
-                TS_ASSERT: self.assertFalse
-            },
-            {
-                TS_VALUE: "-200; 182",
-                TS_CONF: {TYPE: COORDINATES},
-                TS_ASSERT: self.assertFalse
-            },
-            {
-                TS_VALUE: "20, 40",
-                TS_CONF: {TYPE: COORDINATES},
-                TS_ASSERT: self.assertFalse
-            },
-            {
-                TS_VALUE: "abc def",
-                TS_CONF: {TYPE: COORDINATES},
-                TS_ASSERT: self.assertFalse
-            },
-            {
-                TS_VALUE: 123,
-                TS_CONF: {TYPE: COORDINATES},
-                TS_ASSERT: self.assertFalse
-            },
-        ]
-
-        for test in tests:
-            value = test[TS_VALUE]
-            conf = test[TS_CONF]
-            assert_func = test[TS_ASSERT]
-            with self.subTest(value=value):
-                assert_func(is_valid_coords(value, conf))
-
-    def test_is_valid_number(self):
-        tests = [
-            {
-                TS_VALUE: 1,
-                TS_CONF: {TYPE: NUMBER},
-                TS_ASSERT: self.assertTrue
-            },
-            {
-                TS_VALUE: 2.5,
-                TS_CONF: {TYPE: NUMBER},
-                TS_ASSERT: self.assertTrue
-            },
-            {
-                TS_VALUE: "10",
-                TS_CONF: {TYPE: NUMBER},
-                TS_ASSERT: self.assertTrue
-            },
-            {
-                TS_VALUE: "10.5",
-                TS_CONF: {TYPE: NUMBER},
-                TS_ASSERT: self.assertTrue
-            },
-            {
-                TS_VALUE: 5,
-                TS_CONF: {TYPE: NUMBER, "min": 0},
-                TS_ASSERT: self.assertTrue
-            },
-            {
-                TS_VALUE: 5,
-                TS_CONF: {TYPE: NUMBER, "max": 10},
-                TS_ASSERT: self.assertTrue
-            },
-            {
-                TS_VALUE: 5,
-                TS_CONF: {TYPE: NUMBER, "min": 0, "max": 10},
-                TS_ASSERT: self.assertTrue
-            },
-            {
-                TS_VALUE: "hello",
-                TS_CONF: {TYPE: NUMBER},
-                TS_ASSERT: self.assertFalse
-            },
-            {
-                TS_VALUE: 10,
-                TS_CONF: {TYPE: NUMBER, "max": 5},
-                TS_ASSERT: self.assertFalse
-            },
-            {
-                TS_VALUE: 0,
-                TS_CONF: {TYPE: NUMBER, "min": 5},
-                TS_ASSERT: self.assertFalse
-            },
-        ]
-
-        for test in tests:
-            value = test[TS_VALUE]
-            conf = test[TS_CONF]
-            assert_func = test[TS_ASSERT]
-            with self.subTest(value=value):
-                assert_func(is_valid_number(value, conf))
-
-    def test_is_valid_taxon(self):
-        tests = [
-            {
-                TS_VALUE: 'sp. species',
-                TS_CONF: {TYPE: TAXON},
-                TS_ASSERT: self.assertTrue
-            },
-            {
-                TS_VALUE: 'spp species subsp. subspecies',
-                TS_CONF: {TYPE: TAXON},
-                TS_ASSERT: self.assertTrue
-            },
-            {
-                TS_VALUE: 'spp species subsp. subspecies var. variety',
-                TS_CONF: {TYPE: TAXON},
-                TS_ASSERT: self.assertTrue
-            },
-            {
-                TS_VALUE: 'spp taxon',
-                TS_CONF: {TYPE: TAXON},
-                TS_ASSERT: self.assertTrue
-            },
-            {
-                TS_VALUE: 'Candidaceae',
-                TS_CONF: {TYPE: TAXON},
-                TS_ASSERT: self.assertTrue
-            },
-            {
-                TS_VALUE: 'sp sp species',
-                TS_CONF: {TYPE: TAXON},
-                TS_ASSERT: self.assertFalse
-            },
-            {
-                TS_VALUE: 'spp species abc. def',
-                TS_CONF: {TYPE: TAXON},
-                TS_ASSERT: self.assertFalse
-            },
-        ]
-
-        for test in tests:
-            value = test[TS_VALUE]
-            conf = test[TS_CONF]
-            assert_func = test[TS_ASSERT]
-            with self.subTest(value=value):
-                assert_func(is_valid_taxon(value, conf))
-
-    def test_is_valid_unique(self):
-        tests = [
-            {
-                TS_VALUE: "abc",
-                TS_CONF: {
-                    TYPE: UNIQUE,
-                    "label": "values",
-                    "shown_values": {}
-                },
-                TS_ASSERT: self.assertTrue
-            },
-            {
-                TS_VALUE: "jkl",
-                TS_CONF: {
-                    TYPE: UNIQUE,
-                    "label": "values",
-                    "shown_values": {
-                        "values": {"abc": '',
-                                   "def": '',
-                                   "ghi": ''},
-                    }
-                },
-                TS_ASSERT: self.assertTrue
-            },
-            {
-                TS_VALUE: "abc",
-                TS_CONF: {
-                    TYPE: UNIQUE,
-                    "label": "values",
-                    "shown_values": {
-                        "values": {"abc": '',
-                                   "def": '',
-                                   "ghi": ''},
-                    }
-                },
-                TS_ASSERT: self.assertFalse
-            },
-        ]
-
-        for test in tests:
-            value = test[TS_VALUE]
-            conf = test[TS_CONF]
-            assert_func = test[TS_ASSERT]
-            with self.subTest(value=value):
-                assert_func(is_valid_unique(value, conf))
-
-    def test_is_valid_file(self):
-        tests = [
-            {
-                TS_VALUE: TEST_DATA_DIR / "invalid_structure.mirri.xlsx",
-                TS_ASSERT: self.assertTrue
-            },
-            {
-                TS_VALUE: TEST_DATA_DIR / "invalid_excel.mirri.json",
-                TS_ASSERT: self.assertFalse
-            },
-        ]
-
-        for test in tests:
-            value = test[TS_VALUE]
-            assert_func = test[TS_ASSERT]
-            with self.subTest(value=value):
-                assert_func(is_valid_file(value,))
-
-
-if __name__ == "__main__":
-    import sys
-    # sys.argv = ['',
-    #             'ValidatoionFunctionsTest.test_is_valid_regex']
-    unittest.main()

tests/test_writers.py

@@ -1,24 +0,0 @@
-
-import unittest
-from pathlib import Path
-from mirri.io.writers.mirri_excel import write_mirri_excel
-from mirri.io.parsers.mirri_excel import parse_mirri_excel
-
-TEST_DATA_DIR = Path(__file__).parent / "data"
-
-
-class MirriExcelTests(unittest.TestCase):
-    def test_valid_excel(self):
-        in_path = TEST_DATA_DIR / "valid.mirri.full.xlsx"
-        parsed_data = parse_mirri_excel(in_path.open('rb'), version="20200601")
-        strains = parsed_data["strains"]
-        growth_media = parsed_data["growth_media"]
-        out_path = Path("/tmp/test.xlsx")
-
-        write_mirri_excel(out_path, strains, growth_media, version="20200601")
-
-
-if __name__ == "__main__":
-    # import sys;sys.argv = ['',
-    #                        'BiolomicsWriter.test_mirri_excel_parser_invalid']
-    unittest.main()

validation/error_logging/error.py

@@ -62,6 +62,10 @@ class Entity():
     def GID(self) -> str:
         return 'Genomic Information'
 
+       
+    def VRS(self) -> str:
+        return 'Version'     
+
     def OTD(self) -> str:
         return 'Ontobiotope'
 

validation/error_logging/error_message.py

@@ -0,0 +1,547 @@
+from typing import Optional
+
+
+class ErrorMessage():
+    """Error message
+
+    Args:
+        code (str): Error code.
+        pk (str | optional): The instance's primary key that triggered the error. Defaults to None.
+        value (str | optional): The instance's value that triggered the error. Defaults to None.
+    """
+
+    def __init__(self, code: str, pk: Optional[str] = None, value: Optional[str] = None):
+        self.code = code.upper()
+        self.pk = pk
+        self.value = value
+
+    @property
+    def _codes(self) -> list:
+        return [
+            func
+            for func in dir(self)
+            if func.isupper() and
+            callable(getattr(self, func)) and
+            not func.startswith("__")
+        ]
+
+    @property
+    def _messages(self) -> dict:
+        return {code: getattr(self, code) for code in self._codes}
+
+    @property
+    def message(self) -> str:
+        if not self._validate_code():
+            raise ValueError(f"{self.code} not found")
+        return self._messages[self.code]()
+
+    @property
+    def code(self) -> str:
+        return self._code
+
+    @code.setter
+    def code(self, code: str) -> None:
+        self._code = code.upper()
+
+    def _validate_code(self) -> bool:
+        return self.code in self._codes
+
+    @property
+    def pk(self) -> str:
+        return self._pk
+
+    @pk.setter
+    def pk(self, pk: str) -> None:
+        self._pk = pk
+
+    @property
+    def value(self) -> str:
+        return self._value
+
+    @value.setter
+    def value(self, value: str) -> None:
+        self._value = value
+
+    """
+        Excel File Structure Error Codes
+    """
+
+    def EXL00(self):
+        return f"The provided file '{self.pk}' is not an excel(xlsx) file"
+
+    def EFS01(self):
+        return "The 'Growth media' sheet is missing. Please check the provided excel template."
+
+    def EFS02(self):
+        return "The 'Geographic origin' sheet is missing. Please check the provided excel template."
+
+    def EFS03(self):
+        return "The 'Literature' sheet is missing. Please check the provided excel template."
+
+    def EFS04(self):
+        return "The 'Sexual state' sheet is missing. Please check the provided excel template."
+
+    def EFS05(self):
+        return "The 'Strains' sheet is missing. Please check the provided excel template."
+
+    def EFS06(self):
+        return "The 'Ontobiotope' sheet is missing. Please check the provided excel template."
+
+    def EFS07(self):
+        return "The 'Markers' sheet is missing. Please check the provided excel template."
+
+    def EFS08(self):
+        return "The 'Genomic information' sheet is missing. Please check the provided excel template."
+    
+    def EFS09(self):
+        return "The 'Version' sheet is missing. Please check the provided excel template."
+
+    """
+        Growth Media Error Codes
+    """
+
+    def GMD01(self):
+        return "The 'Acronym' column is a mandatory field in the Growth Media sheet."
+
+    def GMD02(self):
+        return "The 'Acronym' column is empty or has missing values."
+
+    def GMD03(self):
+        return "The 'Description' column is a mandatory field in the Growth Media sheet. The column can not be empty."
+
+    def GMD04(self):
+        return f"The 'Description' for growth media with Acronym {self.pk} is missing."
+
+    """
+        Geographic Origin Error Codes
+    """
+
+    def GOD01(self):
+        return "The 'ID' column is a mandatory field in the Geographic Origin sheet."
+
+    def GOD02(self):
+        return "The 'ID' column is empty or has missing values."
+
+    def GOD03(self):
+        return "The 'Country' column is a mandatory field in the Geographic Origin sheet. The column can not be empty."
+
+    def GOD04(self):
+        return f"The 'Country' for geographic origin with ID {self.pk} is missing."
+
+    def GOD05(self):
+        return f"The 'Country' for geographic origin with ID {self.pk} is incorrect."
+
+    def GOD06(self):
+        return f"The 'Locality' column is a mandatory field in the Geographic Origin sheet. The column can not be empty."
+
+    def GOD07(self):
+        return f"The 'Locality' for geographic origin with ID {self.pk} is missing."
+
+    """
+        Literature Error Codes
+    """
+
+    def LID01(self):
+        return "The 'ID' column is a mandatory field in the Literature sheet."
+
+    def LID02(self):
+        return "The 'ID' column empty or missing values."
+
+    def LID03(self):
+        return "The 'Full reference' column is a mandatory field in the Literature sheet. The column can not be empty."
+
+    #def LID04(self):
+        #return f"The 'Full reference' for literature with ID {self.pk} is missing."
+
+    def LID05(self):
+        return "The 'Authors' column is a mandatory field in the Literature sheet. The column can not be empty."
+
+    #def LID06(self):
+        #return f"The 'Authors' for literature with ID {self.pk} is missing."
+
+    def LID07(self):
+        return "The 'Title' column is a mandatory field in the Literature sheet. The column can not be empty."
+
+    #def LID08(self):
+        #return f"The 'Title' for literature with ID {self.pk} is missing."
+
+    def LID09(self):
+        return "The 'Journal' column is a mandatory field in the Literature sheet. The column can not be empty."
+
+    #def LID10(self):
+        #return f"The 'Journal' for literature with ID {self.pk} is missing."
+
+    def LID11(self):
+        return "The 'Year' column is a mandatory field in the Literature sheet. The column can not be empty."
+
+    def LID12(self,):
+        return f"The 'Year' for literature with ID {self.pk} is missing."
+
+    def LID13(self):
+        return "The 'Volume' column is a mandatory field in the Literature sheet. The column can not be empty."
+
+    def LID14(self):
+        return f"The 'Volume' for literature with ID {self.pk} is missing."
+
+    def LID15(self):
+        return "The 'First page' column is a mandatory field. The column can not be empty."
+
+    def LID16(self):
+        return f"The 'First page' for literature with ID {self.pk} is missing."
+
+    def LID17(self):
+        return( f"There are four types of ways to fill in the 'Literature' sheet.",
+                "1st- Columns 'ID' and 'DOI' must be obrigatory.",
+                "2nd-Columns 'ID' and 'PMID' are obrigatory.",
+                "3rd-Columns 'ID' and 'Full reference' are obrigatory.",
+                "In the alternative of these three types of forms not being filled in, we have:",
+                "4th-Columns 'ID', 'Authors', 'Title', 'Journal', 'Year', 'Volume', 'First page'.")
+        
+    def LID18(self):
+        return "The 'PMID' column is a mandatory field. The column can not be empty."
+
+    #def LID19(self):
+        #return f"PMID for literature with ID {self.pk} is missing."
+    
+    def LID20(self):
+        return "The 'DOI' column is a mandatory field. The column can not be empty."
+
+    #def LID21(self):
+        #return f"DOI for literature with ID {self.pk} is missing."
+
+    """
+        Strains Error Codes
+    """
+    def STD01(self):
+        return "The 'accessionNumber' column is a mandatory field in the Strains sheet."
+
+    def STD02(self):
+        return "The 'accessionNumber' column is empty or has missing values."
+
+    def STD03(self):
+        return f"The 'accessionNumber' must be unique. The '{self.value}' is repeated."
+
+    def STD04(self):
+        return (f"The 'accessionNumber' {self.pk} is not according to the specification."
+                " The value must be of the format '<Sequence of characters> <sequence of characters>'.")
+
+    def STD05(self):
+        return f"The 'useRestrictions' column is a mandatory field in the Strains Sheet. The column can not be empty."
+
+    def STD06(self):
+        return f"The 'useRestrictions' for strain with accessionNumber {self.pk} is missing."
+
+    def STD07(self):
+        return (f"The 'useRestrictions' for strain with accessionNumber {self.pk} is not according to the specification."
+                f" Your value is {self.value} and the accepted values are 1, 2, 3.")
+
+    def STD08(self):
+        return f"The 'nagoyaConditions' column is a mandatory field in the Strains Sheet. The column can not be empty."
+
+    def STD09(self):
+        return f"The 'nagoyaConditions' for strain with accessionNumber {self.pk} is missing."
+
+    def STD10(self):
+        return (f"The 'nagoyaConditions' for strain with accessionNumber {self.pk} is not according to the specification."
+                f" Your value is {self.value} and the accepted values are 1, 2, 3.")
+
+    def STD11(self):
+        return (f"The 'registeredCollection' for strain with accessionNumber {self.pk} is not according to specification."
+                f" Your value is {self.value} and the accepted values are 1, 2, 3.")
+
+    def STD12(self):
+        return "The 'riskGroup' column is a mandatory field in the Strains Sheet. The column can not be empty."
+
+    def STD13(self):
+        return f"The 'riskGroup' for strain with accessionNumber {self.pk} is missing."
+
+    def STD14(self):
+        return (f"The 'riskGroup' for strain with accessionNumber {self.pk} is not according to specification."
+                f" Your value is {self.value} and the accepted values are 1, 2, 3, 4.")
+
+    def STD15(self):
+        return (f"The 'dualUse' for strain with accessionNumber {self.pk} is not according to specification."
+                f" Your value is {self.value} and the accepted values are 1, 2.")
+
+    def STD16(self):
+        return (f"The “euQuarantine” for strain with accessionNumber {self.pk} is not according to specification."
+                f" Your value is {self.value} and the accepted values are 1, 2.")
+
+    def STD17(self):
+        return f"The 'organismType' column is a mandatory field in the Strains Sheet. The column can not be empty."
+
+    def STD18(self):
+        return f"The 'organismType' for strain with accessionNumber {self.pk} is missing."
+
+    def STD19(self):
+        return (f"The 'organismType' for strain with accessionNumber {self.pk} is not according to specification."
+                f" Your value is {self.value} and the accepted values are 'Algae', 'Archaea', 'Bacteria', 'Cyanobacteria', "
+                "'Filamentous Fungi',  'Phage', 'Plasmid', 'Virus', 'Yeast', 1, 2, 3, 4, 5, 6, 7, 8, 9.")
+
+    def STD20(self):
+        return f"The 'speciesName' column is a mandatory field in the Strains Sheet. The column can not be empty."
+
+    def STD21(self):
+        return f"The 'speciesName' for strain with accessionNumber {self.pk} is missing."
+
+    def STD22(self):
+        return f"The 'speciesName' for strain with accessionNumber {self.pk} is incorrect."
+
+    def STD23(self):
+        return (f"The 'hybrid' for strain with accessionNumber {self.pk} is not according to specification."
+                f" Your value is {self.value} and the accepted values are 1, 2.")
+
+    def STD24(self):
+        return (f"The 'depositHistory' for strain with accessionNumber {self.pk} is incorrect."
+                "The field includes entries separated by '<' meaning 'received from'."
+                "Entries may include persons or CCs. The name of the CC should be followed by"
+                "the month, when available, and year of the acquisition. Between parentheses,"
+                "the strain designation or CC numbers and/or a name can also be entered when "
+                "a name change has occurred.")
+
+    def STD25(self):
+        return (f"The 'depositDate' for strain with accessionNumber {self.pk} is incorrect."
+                " The allowed formats are 'YYYY-MM-DD', 'YYYYMMDD', 'YYYYMM', and 'YYYY'.")
+
+    def STD26(self):
+        return (f"The 'accessionDate' for strain with accessionNumber {self.pk} is incorrect."
+                " The allowed formats are 'YYYY-MM-DD', 'YYYYMMDD', 'YYYYMM', and 'YYYY'.")
+
+    def STD27(self):
+        return (f"The 'collectionDate' for strain with accessionNumber {self.pk} is incorrect."
+                " The allowed formats are 'YYYY-MM-DD', 'YYYYMMDD', 'YYYYMM', and 'YYYY'.")
+
+    def STD28(self):
+        return (f"The 'isolationDate' for strain with accessionNumber {self.pk} is incorrect."
+                " The allowed formats are 'YYYY-MM-DD', 'YYYYMMDD', 'YYYYMM', and 'YYYY'.")
+
+    def STD29(self):
+        return (f"The 'temperatureGrowthRange' for strain with accessionNumber {self.pk} is incorrect."
+                " It must have two decimal numbers separated by ','")
+
+    def STD30(self):
+        return f"The 'temperatureGrowthRange' column is a mandatory field in the Strains Sheet. The column can not be empty."
+
+    def STD31(self):
+        return f"The 'temperatureGrowthRange' for strain with accessionNumber {self.pk} is missing."
+
+    def STD32(self):
+        return (f"The 'temperatureGrowthRange' for strain with accessionNumber {self.pk} is incorrect."
+                " It must have two decimal numbers separated by ','.")
+
+    def STD33(self):
+        return ("The 'recommendedTemperature' column is a mandatory field in the Strains Sheet. The column can not be empty.")
+
+    def STD34(self):
+        return f"The 'recommendedTemperature' for strain with accessionNumber {self.pk} is missing."
+
+    def STD35(self):
+        return f"The value of 'recommendedTemperature' for strain with accessionNumber {self.pk} is not in the Growth Media Sheet."
+
+    def STD36(self):
+        return f"The 'supplyForms' column is a mandatory field in the Strains Sheet. The column can not be empty."
+
+    def STD37(self):
+        return f"The 'supplyForms' for strain with accessionNumber {self.pk} is missing."
+
+    def STD38(self):
+        return f"The value of 'supplyForms' for strain with accessionNumber {self.pk} is not in the Forms of Supply Sheet."
+
+    def STD39(self):
+        return (f"The 'geographicCoordinates' column for strain with accessionNumber {self.pk} is incorrect."
+                "The allowed formats are two, three or four decimal numbers separated by ','. Moreover, the first number must be."
+                "between [-90, 90], the second between [-180, 180], and the third and fourth refers to the precision and altitude, defined by decimal numbers." 
+                "Put a question mark for lack of precision or altitude when one of them is missing. Leave the values blank when both are missing. ")
+
+    def STD40(self):
+        return (f"The 'country' column for strain with accessionNumber {self.pk} is incorrect."
+                "The allowed formats are one decimal number between [-200, 8000].")
+    def STD54(self):
+        return (f"The 'country'column is a mandatory field in the Strains Sheet. The column can not be empty.")
+    def STD55(self):
+        return (f"The 'country' for strain with accessionNumber {self.pk} is missing.")
+
+    def STD41(self):
+        return f"The value of 'ontobiotopeTerms' for strain with accessionNumber {self.pk} is not in the Ontobiotope Sheet."
+
+    def STD42(self):
+        return (f"The 'gmo' for strain with accessionNumber {self.pk} is not according to specification."
+                f" Your value is {self.value} and the accepted values are 1, 2")
+
+    def STD43(self):
+        return (f"The 'sexualState' for strain with accessionNumber {self.pk} is not according to specification."
+                f" Your value is {self.value} and the accepted values are 'Mata', 'Matalpha', 'Mata/Matalpha', "
+                "'Matb', 'Mata/Matb', 'MTLa', 'MTLalpha', 'MTLa/MTLalpha', 'MAT1-1', 'MAT1-2', 'MAT1', 'MAT2', 'MT+', 'MT-'")
+
+    def STD44(self):
+        return (f"The 'ploidy' for strain with accessionNumber {self.pk} is not according to specification."
+                f" Your value is {self.value} and the accepted values are 0, 1, 2, 3, 4, 9")
+
+    def STD45(self):
+        msg = f"At least one of the values '{self.value}' of the literature field for strain {self.pk} are not in the literature sheet. "
+        msg += "If the those values are Pubmed ids or DOIs, please ignore this messsage"
+        return msg
+
+    def STD46(self):
+       return (f"The 'geographicOrigin' for strain with accessionNumber {self.pk} is not according to specification."
+           f"The 'geographicOrigin' column must consist of the ID's associated with the Geographic origin sheet.")
+
+    def STD47(self):
+        return "The 'country' column is a mandatory field in the Strains sheet."
+
+    def STD48(self):
+        return "The 'country' column is empty or has missing values."
+
+    def STD49(self):
+        return (f"The “qps” for strain with accessionNumber {self.pk} is not according to specification."
+            f" Your value is {self.value} and the accepted values are 1, 2.")
+        
+    def STD50(self):
+        return (f"The “axenicCulture” for strain with accessionNumber {self.pk} is not according to specification."
+        f" Your value is {self.value} and the accepted values are 'Axenic', 'Not axenic'.")    
+
+    def STD51(self):
+        return f"The 'mirriAccessionNumber' must be unique. The '{self.pk}' is repeated."
+    
+    def STD52(self): 
+        return (f"The 'mirriAccessionNumber' for strain with accessionNumber {self.pk} is incorrect."
+                " It must have the expression MIRRI followed by 7 digits")
+    
+    def STD53(self): 
+        return (f"The 'siteLinks' for strain with accessionNumber {self.pk} is incorrect."
+                " The displayed expression it should be composed of: site name ';' website url." )
+    
+    def STD56(self): 
+        return (f"The 'siteLinks' for strain with accessionNumber {self.pk} is incorrect."
+                " The url must be valid. " )    
+    def STD57(self): 
+        return (f"The 'country' for strain with accessionNumber {self.pk} is incorrect."
+                "This information must be expressed by using the ISO-3166 standard for country" 
+                "codes. The preferred set is ISO 3166-1 alpha-2 (two letters code), but ISO 3166-"
+                "1 alpha-3 (three letters code) is also accepted. Former country codes must" 
+                "follow standard’s part three ISO 3166-3 (four letters code). Only one code can" 
+                "be included." )    
+    def STD58(self): 
+        return (f"The 'mtaFile' for strain with accessionNumber {self.pk} is incorrect."
+                " The url must be valid. " )    
+    def STD59(self): 
+        return (f"The 'absFile' for strain with accessionNumber {self.pk} is incorrect."
+                "The displayed expression it should be composed of: name ';' website url."
+                "When only one URL is provided, the title may be omitted. In this case, the URL" 
+                "will be shown in clear to users." ) 
+    def STD60(self): 
+        return (f"The 'absFile' for strain with accessionNumber {self.pk} is incorrect."
+                 " The url must be valid. ")              
+    def STD61(self): 
+        return (f"The 'sequenceLiterature' for strain with accessionNumber {self.pk} is incorrect."
+                 "Numeric identifiers separated by a semicolon ';'.")   
+    
+    def STD62(self): 
+        return (f"The 'plasmidCollections' for strain with accessionNumber {self.pk} is incorrect."
+                "It should include the name of the plasmid followed by the CC number in"
+                "parentheses. More than one plasmid can be reported, separated by ';'. "
+                "Plasmid names should be provided as free text."
+                "CC numbers should be composed by the CC acronym followed by a number"
+                "separated by a space'. Numeric identifiers separated by a semicolon ';'.")  
+              
+    def STD63(self): 
+        return (f"The 'otherCollectionNumbers' for strain with accessionNumber {self.pk} is incorrect."
+                " The value must be of the format '<Sequence of characters> <sequence of characters>'.")
+        
+    def STD64(self): 
+        return (f"The 'type' for strain with accessionNumber {self.pk} is incorrect."
+              f"Your value is {self.value} and the accepted values are 1, 2.")
+        
+    def STD65(self): 
+        return (f"The 'status' for strain with accessionNumber {self.pk} is incorrect."
+                "The structure should be 'type of <character string>.")
+        
+    def STD68(self):
+        return (f"The 'geographicOrigin'column is a mandatory field in the Strains Sheet. The column can not be empty.")
+    
+    def STD69(self):
+        return (f"The 'geographicOrigin' for strain with accessionNumber {self.pk} is missing.")
+            
+    """
+        Genomic Information Error Codes
+    """
+
+    def GID01(self):
+        return f"The 'Strain accessionNumber' (Strain AN) column is a mandatory field in the Genomic Information Sheet."
+
+    def GID02(self):
+        return f"The 'Strain accessionNumber' (Strain AN) column is empty or has missing values."
+
+    def GID03(self):
+        return f"The value of 'Strain accessionNumber' (Strain AN) {self.value} is not in the Strains sheet."
+
+    def GID04(self):
+        return f"The 'Marker' column is a mandatory field in the Genomic Information Sheet. The column can not be empty."
+
+    def GID05(self):
+        return f"The 'Marker' for genomic information with Strain AN {self.pk} is missing."
+
+    def GID06(self):
+        return f"The value of 'Marker' {self.value} is not in the Markers sheet."
+
+    def GID07(self):
+        return f"The 'INSDC AN' column is a mandatory field in the Genomic Information Sheet. The column can not be empty."
+
+    def GID08(self):
+        return f"The 'INSDC AN' for genomic information with Strain AN {self.pk} is missing."
+
+    def GID09(self):
+        return f"The 'INSDC AN' for genomic information with Strain AN {self.pk} is incorrect."
+
+    def GID10(self):
+        return (f"The 'Sequence' for genomic information with Strain AN {self.pk} is incorrect."
+                " It must be a sequence of 'G', 'T', 'A', 'C' characteres of any length and without white spaces.")
+
+    def GID11(self):
+        return (f"The 'Sequence' for genomic information with Strain AN {self.pk} is incorrect."
+                "An INSDC accession number is an alphanumeric"
+                "code made by a fixed number of letters followed by a fixed number of digits," 
+                "without any separation. For sequences, the code is currently made of two" 
+                "letters followed by six numbers.")
+
+
+    """
+    Version Error Codes
+    """
+
+    def VRS01(self):
+        return "The 'Version' columns is a mandatory field in the Version Sheet."
+
+    def VRS02(self):
+        return "The 'Version' columns is empty or has missing values."
+    
+    def VRS03(self):
+        return "The 'Date' columns is a mandatory field in the Control Sheet."
+
+    def VRS04(self):
+        return "The 'Date' columns is empty or has missing values."
+
+    def VRS05(self):
+        return f"The version {self.value} is the only one to be used."
+
+
+
+    """
+        Ontobiotope Error Codes
+    """
+
+    def OTD01(self):
+        return "The 'ID' columns is a mandatory field in the Ontobiotope Sheet."
+
+    def OTD02(self):
+        return "The 'ID' columns is empty or has missing values."
+
+    #def OTD03(self):
+        return "The 'Name' columns is a mandatory field in the Ontobiotope Sheet. The column can not be empty."
+
+    #def OTD04(self):
+        return f"The 'Name' for ontobiotope with ID {self.pk} is missing."
+
+    
+
+    

validation/excel_validator.py

@@ -4,27 +4,51 @@ from io import BytesIO
 from zipfile import BadZipfile
 from datetime import datetime
 from calendar import monthrange
-
+import requests
 from openpyxl import load_workbook
+import pycountry
 
 from mirri.io.parsers.excel import workbook_sheet_reader, get_all_cell_data_from_sheet
 from mirri.validation.error_logging import ErrorLog, Error
 from mirri.validation.tags import (CHOICES, COLUMNS, COORDINATES, CROSSREF, CROSSREF_NAME, DATE,
                                    ERROR_CODE, FIELD, MANDATORY, MATCH,
-                                   MISSING, MULTIPLE, NAGOYA, NUMBER, REGEXP, ROW_VALIDATION, SEPARATOR, TAXON,
-                                   TYPE, UNIQUE, VALIDATION, VALUES, BIBLIO)
+                                   MISSING, MULTIPLE, NAGOYA, REGEXP, ROW_VALIDATION, SEPARATOR, TAXON,
+                                   TYPE, UNIQUE, VALIDATION, VALUES, BIBLIO, DOMINIO,URL_DOMINIO, ISO, URL_TITLE,JUST_URL,TITLE,
+                                   HISTORY,NAGOYA1, VERSION)
 from mirri.settings import LOCATIONS, SUBTAXAS
-from mirri.validation.validation_conf_20200601 import MIRRI_20200601_VALLIDATION_CONF
+from mirri.validation.validation_conf_12052023 import version_config
+
+from mirri.validation.validation_conf_12052023 import MIRRI_12052023_VALLIDATION_CONF
 
 
-def validate_mirri_excel(fhand, version="20200601"):
-    if version == "20200601":
-        configuration = MIRRI_20200601_VALLIDATION_CONF
+def validate_mirri_excel(fhand, version= "5.1.2" ):
+    if  version == "5.1.2":
+        configuration = MIRRI_12052023_VALLIDATION_CONF            
     else:
-        raise NotImplementedError("Only version20200601 is implemented")
+        raise NotImplementedError("Only version 5.1.2 is implemented")
     
     return validate_excel(fhand, configuration)
 
+def version(value , validation_conf=None):
+    if value is None:
+        return True
+    try: 
+        for version in version_config:
+            if value == version :
+                return True
+    except:
+        return False    
+    
+        
+def validate_country_code(value,validation_conf=None):
+    if value is None:
+        return True
+    try:  
+        if pycountry.countries.get(alpha_2=value) or pycountry.countries.get(alpha_3=value) or pycountry.historic_countries.get(alpha_4 = value):
+            return True
+    except:
+        return False
+
 
 def validate_excel(fhand, configuration):
     validation_conf = configuration['sheet_schema']
@@ -185,11 +209,14 @@ def validate_row(row, validation_steps, in_memory_sheets):
         kind = validation_step[TYPE]
         error_code = validation_step[ERROR_CODE]
         if kind == NAGOYA:
-            if not is_valid_nagoya(row, in_memory_sheets):
+            if not is_valid_nagoya_v12052023(row, in_memory_sheets):
                 return error_code
         elif kind == BIBLIO:
             if not is_valid_pub(row):
                 return error_code
+        elif kind == NAGOYA1:
+            if not is_valid_nago(row):
+                return error_code    
         else:
             msg = f'{kind} is not a recognized row validation type method'
             raise NotImplementedError(msg)
@@ -208,48 +235,69 @@ def validate_cell(value, validation_steps, crossrefs, shown_values, label):
         if error_code is not None:
             return error_code
    
-
 def is_valid_pub(row):
+    pub_id = row.get('ID', None)
+    pub_pmid = row.get('PMID', None)
+    pub_doi = row.get('DOI', None)
     title = row.get('Title', None)
     full_reference = row.get('Full reference', None)
     authors = row.get('Authors', None)
     journal = row.get('Journal', None)
     year = row.get('Year', None)
-    volumen = row.get('Volumen', None)
+    volumen = row.get('Volume', None)
     first_page = row.get('First page', None)
     book_title = row.get('Book title', None)
     editors = row.get('Editors', None)
     publishers = row.get('Publishers', None)
 
-    if full_reference:
+    if (pub_id != None and pub_doi != None) or (pub_id != None and pub_pmid != None) or (pub_id != None and full_reference != None) or (pub_id != None and authors != None and title != None and journal != None and year != None and volumen != None and first_page != None) :
         return True
     is_journal = bool(title)
 
-    if (is_journal and (not authors  or not journal or not not year or
-                        not volumen or not first_page)):
-        return False
-    if (not is_journal and (not authors or not year or
-                            not editors or not publishers or not book_title)):
-        return False
+   # if (is_journal and (not authors  or not journal or not not year or
+    #                    not volumen or not first_page)):
+     #   return False
+    #if (not is_journal and (not authors or not year or
+     #                       not editors or not publishers or not book_title)):
+      #  return False
 
+    return False
+
+def is_valid_nago(row):
+    if not row:
+        return True
+    status = row.get("status", None)
+    type = row.get("type", None)
+    regex = r'^[a-zA-Z\s.\'-]+$'
+    
+    if status != None and type != None:
+        if (re.match(regex, status) and type==1):
+            return False
+    if (type == 2 and status is None):
+        return False
     return True
 
+def parsee_mirri_excel(row, in_memory_sheets, version=""):
+    if version == "12052023":
+        return is_valid_nagoya_v12052023 (row, in_memory_sheets)            
+    else:
+        raise NotImplementedError("Only version is implemented")
 
-def is_valid_nagoya(row, in_memory_sheets):  # sourcery skip: return-identity
-    location_index = row.get('Geographic origin', None)
+def is_valid_nagoya_v12052023(row, in_memory_sheets):  # sourcery skip: return-identity
+    location_index = row.get('geographicOrigin', None)
     if location_index is None:
         country = None
     else:
         geo_origin = in_memory_sheets[LOCATIONS].get(location_index, {})
         country = geo_origin.get('Country', None)
 
-    _date = row.get("Date of collection", None)
+    _date = row.get("collectionDate", None)
     if _date is None:
-        _date = row.get("Date of isolation", None)
+        _date = row.get("isolationDate", None)
     if _date is None:
-        _date = row.get("Date of deposit", None)
+        _date = row.get("depositDate", None)
     if _date is None:
-        _date = row.get("Date of inclusion in the catalogue", None)
+        _date = row.get("accessionDate", None)
     if _date is not None:
         year = _date.year if isinstance(_date, datetime) else int(str(_date)[:4])
     else:
@@ -258,8 +306,8 @@ def is_valid_nagoya(row, in_memory_sheets):  # sourcery skip: return-identity
     if year is not None and year >= 2014 and country is None:
         return False
 
-    return True
         
+    return True
 
 def is_valid_regex(value, validation_conf):
     if value is None:
@@ -310,7 +358,9 @@ def is_valid_choices(value, validation_conf):
         values = [v.strip() for v in str(value).split(separator)]
     else:
         values = [str(value).strip()]
-
+    sorted_values = sorted(values)
+    if sorted_values != values:
+        return False
     return all(value in choices for value in values)
 
 
@@ -352,20 +402,136 @@ def is_valid_date(value, validation_conf):
     return True
 
 
-def is_valid_coords(value, validation_conf=None):
-    # sourcery skip: return-identity
+def is_valid_dominio(value, validation_conf=None):
     if value is None:
         return True
     try:
         items = [i.strip() for i in value.split(";")]
-        latitude = float(items[0])
-        longitude = float(items[1])
-        if len(items) > 2:
-            precision = float(items[2])
-        if latitude < -90 or latitude > 90:
-            return False
-        if longitude < -180 or longitude > 180:
+        if len(items) >1:
+            for i in range(0, len(items),2):
+                nameSite = str(items[i])
+                urlSite = str(items[i+1])
+                dominio = urlSite.split(".")[-2]
+                if nameSite.lower() != dominio:
+                    return False
+        
+        return True
+    except:
+        return False  
+
+def is_valid_title(value, validation_conf=None):
+    if value is None:
+        return True
+    try:
+        items = [i.strip() for i in value.split(";")]
+        if len(items) >1:
+            for i in range(0, len(items),2):
+                nameSite = (items[i])
+                urlSite = str(items[i+1])
+                regex = r'^(http|https):\/\/[a-z0-9\-\.]+\.[a-z]{2,}([/a-z0-9\-\.]*)*$'
+                if  re.match(regex, nameSite)  or isinstance(nameSite, int) or nameSite == '':
+                    return False
+        return True
+    except:
+        return False  
+    
+def is_valid_url_title(value, validation_conf=None):
+    if value is None:
+        return True
+    try:
+        items = [i.strip() for i in value.split(";")]
+        if len(items) ==1:
+            urlSite = str(items[0])
+            response = requests.head(urlSite)
+            if response.status_code != 200:
+                return False
+            
+        else:
+            items = [i.strip() for i in value.split(";")]
+            for i in range(0, len(items),2):
+                nameSite = (items[i])
+                urlSite = str(items[i+1])
+                response = requests.head(urlSite)
+                if response.status_code != 200:
+                    return False
+               
+                    
+        return True
+    except:
+        return False     
+    
+    
+def is_valid_url_dominio(value, validation_conf=None):
+    if value is None:
+        return True
+    try:
+        items = [i.strip() for i in value.split(";")]
+        for i in range(0, len(items),2):
+            nameSite = str(items[i])
+            urlSite = str(items[i+1])
+            response = requests.head(urlSite)
+            if response.status_code != 200:
+                return False
+        
+        return True
+    except:
+        return False        
+     
+    
+def is_valid_just_url(value, validation_conf=None):
+    if value is None:
+        return True
+    try:
+        items = [i.strip() for i in value.split(";")]
+        for i in items:
+            nameSite = str(items[0])
+            response = requests.head(i)
+            if response.status_code != 200:
+                return False
+        
+        return True
+    except:
+        return False 
+     
+    
+def is_valid_history(value, validation_conf=None):
+    if value is None:
+        return True
+    try:
+        items = [i.strip() for i in value.split("<")]
+        for i in items:   
+            regex1 = r'^[a-zA-Z0-9 &,;.:''-]+,?\s*((19|20)\d{2})'
+            regex2 =  r'^[a-zA-Z0-9 &,;.:''-]+,?\s*[a-zA-Z0-9 &,;.''-] (19|20)\d{2}\s\([a-zA-Z0-9 &,;.''-:]+\)'
+            regex3 = r'^[a-zA-Z0-9 &,;.:''-]+\,?\s*[a-zA-Z0-9 &,;.''-]'
+            regex4 = r'^[a-zA-Z0-9 &,;.''-]+,?\s*(19|20)\d{2}\s\([a-zA-Z0-9 .''-,;&:]+\)'
+            regex5 = r'^[a-zA-Z0-9 &,;.:''-]+,?\s*\([a-zA-Z0-9 &,;.''-:]+\) (19|20)\d{2}'
+            if re.match(regex1, i):
+                return True
+            elif re.match(regex2, i):
+                return True
+            elif re.match(regex3, i):
+                return True
+            elif re.match(regex4, i):
+                return True
+            elif re.match(regex5, i):
+                return True
+            else:
+                return False
+    except:
+        return False  
+        
+
+def is_valid_coords(value, validation_conf=None):
+    if value is None:
+        return True
+    try:
+              
+        regex1 = r'^-?(90(\.0+)?|[1-8]?\d(\.\d+)?)(\s*;\s*-?(180(\.0+)?|((1[0-7]\d)|(\d{1,2}))(\.\d+)?))*$'
+        regex2 = r'^-?(90(\.0+)?|[1-8]?\d(\.\d+)?)\s*;\s*-?(180(\.0+)?|((1[0-7]\d)|(\d{1,2}))(\.\d+)?)\s*;\s*(\d+\.\d+|\?)\s*;\s*(\d+\.\d+|\?)$|^(\d+\.\d+|\?)$|^\s*;\s*$'
+
+        if not re.match(regex1, value) and not re.match(regex2, value):
             return False
+    
         return True
     except:
         return False    
@@ -375,24 +541,6 @@ def is_valid_missing(value, validation_conf=None):
     return value is not None
 
 
-def is_valid_number(value, validation_conf):
-    if value is None:
-        return True
-    try:
-        value = float(value)
-    except TypeError:
-        return False
-    except ValueError:
-        return False
-
-    _max = validation_conf.get('max', None)
-    _min = validation_conf.get('min', None)
-    if (_max is not None and value > _max) or (_min is not None and value < _min):
-        return False
-
-    return True
-
-
 def is_valid_taxon(value, validation_conf=None):
     multiple = validation_conf.get(MULTIPLE, False)
     separator = validation_conf.get(SEPARATOR, ';')
@@ -429,6 +577,8 @@ def _is_valid_taxon(value):
 
 
 def is_valid_unique(value, validation_conf):
+    if not value:
+        return True
     label = validation_conf['label']
     shown_values = validation_conf['shown_values']
     if label not in shown_values:
@@ -444,7 +594,6 @@ def is_valid_unique(value, validation_conf):
 
     return True
 
-
 def is_valid_file(path):
     try:
         with path.open("rb") as fhand:
@@ -464,8 +613,15 @@ VALIDATION_FUNCTIONS = {
     CROSSREF: is_valid_crossrefs,
     DATE: is_valid_date,
     COORDINATES: is_valid_coords,
-    NUMBER: is_valid_number,
     TAXON: is_valid_taxon,
+    TITLE: is_valid_title,
+    DOMINIO: is_valid_dominio,
+    URL_TITLE: is_valid_url_title,
+    URL_DOMINIO: is_valid_url_dominio,
+    JUST_URL: is_valid_just_url,
+    ISO: validate_country_code,
+    HISTORY: is_valid_history,
+    VERSION: version,
     UNIQUE: is_valid_unique}
 
 

validation/tags.py

@@ -16,9 +16,20 @@ MATCH = 'match'
 VALUES = 'values'
 DATE = 'date'
 COORDINATES = 'coord'
+COORDINATES1 = 'coord1'
 NUMBER = 'number'
 TAXON = 'taxon'
 UNIQUE = 'unique'
 ROW_VALIDATION = 'row_validation'
 NAGOYA = 'nagoya'
 BIBLIO = 'bibliography'
+DOMINIO= 'is_valid_dominio'
+TITLE= 'is_valid_title'
+URL_DOMINIO = 'urll_valid_dominio'
+URL_TITLE= 'is_valid_url_title'
+ISO = 'validate_country_code'
+JUST_URL= 'is_valid_just_url'
+HISTORY= 'is_valid_history'
+MEU='is_valid_crossrefs_meu'
+NAGOYA1 = 'nayoga1'
+VERSION = 'version'

validation/validate_v5.py

@@ -1,14 +1,20 @@
 #!/usr/bin/env python
+import pandas as pd
 import sys
 from pathlib import Path
-from mirri.validation.excel_validator import validate_mirri_excel
 import warnings    
 warnings.simplefilter("ignore")
-
+from mirri.validation.excel_validator import validate_mirri_excel
 
 def main():
     path = Path(sys.argv[1])
-    error_log = validate_mirri_excel(path.open("rb"))
+    version = str(sys.argv[2])
+    try:
+
+        error_log = validate_mirri_excel(path.open("rb"), version=version)
+        
+    except NotImplementedError as e:
+        print(e)    
 
     for errors in error_log.get_errors().values():
         for error in errors:

validation/validation_conf_12052023.py

@@ -1,10 +1,13 @@
 from mirri.validation.tags import (CHOICES, COLUMNS, COORDINATES, CROSSREF, CROSSREF_NAME, DATE,
                                    ERROR_CODE, FIELD, MANDATORY, MATCH,
-                                   MISSING, MULTIPLE, NAGOYA, NUMBER, REGEXP, ROW_VALIDATION, SEPARATOR, TAXON, TYPE,
-                                   UNIQUE,
-                                   VALIDATION, VALUES, BIBLIO)
+                                   MISSING, MULTIPLE, NAGOYA, REGEXP, ROW_VALIDATION, SEPARATOR, TAXON, TYPE,
+                                   UNIQUE,VERSION,
+                                   VALIDATION, VALUES, BIBLIO, DOMINIO, URL_DOMINIO,ISO, JUST_URL, URL_TITLE, TITLE, HISTORY,NAGOYA1)
 from mirri.settings import (ONTOBIOTOPE, LOCATIONS, GROWTH_MEDIA, GENOMIC_INFO,
-                            STRAINS, LITERATURE_SHEET, SEXUAL_STATE_SHEET, MARKERS)
+                            STRAINS, LITERATURE_SHEET, SEXUAL_STATE_SHEET, MARKERS,  CONTROL_SHEET)
+
+
+
 # GEOGRAPHIC_ORIGIN
 # SEXUAL_STATE_SHEET,
 # RESOURCE_TYPES_VALUES,
@@ -12,9 +15,12 @@ from mirri.settings import (ONTOBIOTOPE, LOCATIONS, GROWTH_MEDIA, GENOMIC_INFO,
 # PLOIDY_SHEET)
 
 
+
+
 STRAIN_FIELDS = [
+       
     {
-        FIELD: "Accession number",
+        FIELD: "accessionNumber",
         VALIDATION: [
             {TYPE: MANDATORY, ERROR_CODE: 'STD01'},
             {TYPE: UNIQUE, ERROR_CODE: 'STD03'},
@@ -23,16 +29,24 @@ STRAIN_FIELDS = [
         ]
     },
     {
-        FIELD: "Restrictions on use",
+        FIELD: "useRestrictions",
         VALIDATION: [
             {TYPE: MANDATORY, ERROR_CODE: "STD05"},
-            {TYPE: MISSING, ERROR_CODE: "STD06"},
+           {TYPE: MISSING, ERROR_CODE: "STD06"},
             {TYPE: CHOICES, VALUES: ["1", "2", "3"],
              MULTIPLE: False, ERROR_CODE: "STD07"}
         ]
     },
+     {
+        FIELD: "mirriAccessionNumber",
+        VALIDATION: [
+            {TYPE: UNIQUE, ERROR_CODE: 'STD51'},
+            {TYPE: REGEXP, MATCH: "^MIRRI[0-9]{7}$", ERROR_CODE: "STD52"},
+            ],
+    },
+    
     {
-        FIELD: "Nagoya protocol restrictions and compliance conditions",
+        FIELD: "nagoyaConditions",
         VALIDATION: [
             {TYPE: MANDATORY, ERROR_CODE: "STD08"},
             {TYPE: MISSING, ERROR_CODE: "STD09"},
@@ -41,29 +55,53 @@ STRAIN_FIELDS = [
         ]
     },
     {
-        FIELD: "ABS related files",
-        VALIDATION: [],
+        FIELD: "absFile",
+        VALIDATION: [
+        {TYPE: TITLE, ERROR_CODE: "STD59"},
+        {TYPE: URL_TITLE, ERROR_CODE: "STD60", 
+         MULTIPLE: True, SEPARATOR: ";"},
+            ],
+    },
+    
+    {
+        FIELD: "siteLinks", 
+        VALIDATION: [
+        {TYPE: DOMINIO, ERROR_CODE: "STD53", 
+         MULTIPLE: False, SEPARATOR: ";"},
+        {TYPE: URL_DOMINIO, ERROR_CODE: "STD56", 
+         MULTIPLE: False, SEPARATOR: ";"},
+    ],
     },
     {
-        FIELD: "MTA file",
-        VALIDATION: [],
+        FIELD: "mtaFile",
+        VALIDATION: [
+        {TYPE: JUST_URL, ERROR_CODE: "STD58", 
+         MULTIPLE: True, SEPARATOR: ";"},
+            ],
     },
     {
-        FIELD: "Other culture collection numbers",
-        # VALIDATION: [
-        #     {TYPE: REGEXP, "match": "[^ ]* [^ ]*", ERROR_CODE: "STD07",
-        #      MULTIPLE: True, SEPARATOR: ";"}
-        # ]
+        FIELD: "otherCollectionNumbers",
+         VALIDATION: [
+            {TYPE: REGEXP, MATCH: "([^ ]* [^ ]*)(; [^ ]* [^ ]*)*$", ERROR_CODE: "STD63",
+             MULTIPLE: True, SEPARATOR: ';'},
+             #{TYPE: CROSSREF, CROSSREF_NAME: "Strains", ERROR_CODE: "STD64"},
+        ]
     },
     {
-        FIELD: "Strain from a registered collection",
+        FIELD: "registeredCollection",
         VALIDATION: [
             {TYPE: CHOICES, VALUES: ["1", "2"],
              ERROR_CODE: "STD11"}
         ]
+    },
+     {
+        FIELD: "type",
+        VALIDATION: [
+            {TYPE: CHOICES, VALUES: ["1", "2"], ERROR_CODE: "STD64"},
+        ]
     },
     {
-        FIELD: "Risk Group",
+        FIELD: "riskGroup",
         VALIDATION: [
             {TYPE: MANDATORY, ERROR_CODE: "STD12"},
             {TYPE: MISSING, ERROR_CODE: "STD13"},
@@ -72,33 +110,41 @@ STRAIN_FIELDS = [
         ]
     },
     {
-        FIELD: "Dual use",
+        FIELD: "dualUse",
         VALIDATION: [
             {TYPE: CHOICES, VALUES: ["1", "2"],
              ERROR_CODE: "STD15"}
         ]
     },
     {
-        FIELD: "Quarantine in Europe",
+        FIELD: "euQuarantine",
         VALIDATION: [
             {TYPE: CHOICES, VALUES: ["1", "2"],
              ERROR_CODE: "STD16"}
         ]
     },
+     {
+        FIELD: "axenicCulture",
+        VALIDATION: [
+            {TYPE: CHOICES, VALUES: ["Axenic", "Not axenic"],
+             ERROR_CODE: "STD50"}
+        ]
+    },
+    
     {
-        FIELD: "Organism type",
+        FIELD: "organismType",
         VALIDATION: [
             {TYPE: MANDATORY, ERROR_CODE: "STD17"},
             {TYPE: MISSING, ERROR_CODE: "STD18"},
             {TYPE: CHOICES, VALUES: ["Algae", "Archaea", "Bacteria",
-                                     "Cyanobacteria", "Filamentous Fungi",
-                                     "Phage", "Plasmid", "Virus", "Yeast",
-                                     "1", "2", "3", "4", "5", "6", "7", "8", "9"],
+                                     "Cyanobacteria", "Filamentous Fungi", "Filamentous fungi",
+                                      "Yeast", "Microalgae",
+                                     "1", "2", "3", "4", "5", "6", "7"],
              MULTIPLE: True, SEPARATOR: ";",  ERROR_CODE: "STD19"}
         ]
     },
     {
-        FIELD: "Taxon name",
+        FIELD: "speciesName",
         VALIDATION: [
             {TYPE: MANDATORY, ERROR_CODE: "STD20"},
             {TYPE: MISSING, ERROR_CODE: "STD21"},
@@ -107,73 +153,69 @@ STRAIN_FIELDS = [
         ]
     },
     {
-        FIELD: "Infrasubspecific names",
+        FIELD: "infrasubspecificNames",
+        VALIDATION: []
     },
     {
-        FIELD: "Comment on taxonomy",
+        FIELD: "taxonomyComments",
+        VALIDATION: []
     },
     {
-        FIELD: "Interspecific hybrid",
+        FIELD: "hybrid",
         VALIDATION: [
             {TYPE: CHOICES, VALUES: ["1", "2"],
              ERROR_CODE: "STD23"}
         ]
     },
     {
-        FIELD: "Status",
+        FIELD: "status",
+        VALIDATION: [
+            {TYPE: REGEXP, MATCH: "^(type of|neotype of|holotype of |epitype of) ([a-zA-Z .'-]+)$", ERROR_CODE: "STD65"},
+            
+        ]
+        
     },
     {
-        FIELD: "History of deposit",
+        FIELD: "depositHistory",
         VALIDATION: [
-            # {TYPE: REGEXP, "match": "[^ ]* [^ ]*", ERROR_CODE: "STD24",  # modify the regex
-            #  MULTIPLE: True, SEPARATOR: ";"}
+             {TYPE: HISTORY, ERROR_CODE: 'STD24'},
         ]
     },
     {
-        FIELD: "Depositor"
+        FIELD: "depositor",
+        VALIDATION: []
     },
     {
-        FIELD: "Date of deposit",
+        FIELD: "depositDate",
         VALIDATION: [
             {TYPE: DATE, ERROR_CODE: "STD25"},
         ]
     },
     {
-        FIELD: "Date of inclusion in the catalogue",
+        FIELD: "accessionDate",
         VALIDATION: [
             {TYPE: DATE, ERROR_CODE: "STD26"},
         ]
     },
     {
-        FIELD: "Collected by",
+        FIELD: "collector",
+        VALIDATION: []
+    },
+    
+    
+    {
+        FIELD: "substrate",
+        VALIDATION: []
     },
     {
-        FIELD: "Date of collection",
-        VALIDATION: [
-            {TYPE: DATE, ERROR_CODE: "STD27"},
-        ]
-    },
-    {
-        FIELD: "Isolated by",
-    },
-    {
-        FIELD: "Date of isolation",
-        VALIDATION: [
-            {TYPE: DATE, ERROR_CODE: "STD28"},
-        ]
-    },
-    {
-        FIELD: "Substrate/host of isolation",
-    },
-    {
-        FIELD: "Tested temperature growth range",
+        FIELD: "temperatureGrowthRange",
         VALIDATION: [
             {TYPE: REGEXP, "match": r'[+-]?(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?',
              ERROR_CODE: "STD29", MULTIPLE: True, SEPARATOR: ";"}
         ]
     },
     {
-        FIELD: "Recommended growth temperature",
+        FIELD: "recommendedTemperature",
         VALIDATION: [
             {TYPE: MANDATORY, ERROR_CODE: "STD30"},
             {TYPE: MISSING, ERROR_CODE: "STD31"},
@@ -182,17 +224,9 @@ STRAIN_FIELDS = [
              MULTIPLE: True, SEPARATOR: ";"}
         ]
     },
+   
     {
-        FIELD: "Recommended medium for growth",
-        VALIDATION: [
-            {TYPE: MANDATORY, ERROR_CODE: "STD33"},
-            {TYPE: MISSING, ERROR_CODE: "STD34"},
-            {TYPE: CROSSREF, CROSSREF_NAME: "Growth media",
-             MULTIPLE: True, SEPARATOR: "/", ERROR_CODE: "STD35"}
-        ]
-    },
-    {
-        FIELD: "Form of supply",
+        FIELD: "supplyForms",
         VALIDATION: [
             {TYPE: MANDATORY, ERROR_CODE: "STD36"},
             {TYPE: MISSING, ERROR_CODE: "STD37"},
@@ -202,52 +236,70 @@ STRAIN_FIELDS = [
         ]
     },
     {
-        FIELD: "Other denomination",
+        FIELD: "otherDenomination",
+        VALIDATION: []
     },
     {
-        FIELD: "Coordinates of geographic origin",
+        FIELD: "geographicCoordinates",
         VALIDATION: [
             {TYPE: COORDINATES, ERROR_CODE: "STD39"},
+            
         ]
     },
-    {
-        FIELD: "Altitude of geographic origin",
-        VALIDATION: [
-            {TYPE: NUMBER, 'max': 8000, 'min': -200, ERROR_CODE: "STD40"},
-        ]
-    },
+    
     {
         # value can be in the cell or in another sheet. Don't configure this
-        FIELD: "Geographic origin",
+        FIELD: "geographicOrigin",
+        VALIDATION: [
+            {TYPE: MANDATORY, ERROR_CODE: "STD68"},
+           {TYPE: MISSING, ERROR_CODE: "STD69"},
+            {TYPE: CROSSREF, CROSSREF_NAME: "Geographic origin", ERROR_CODE: "STD46"},
+        ]
+    },
+    
+    {
+        FIELD: "isolationHabitat",
+        VALIDATION: []
     },
     {
-        FIELD: "Isolation habitat",
-    },
-    {
-        FIELD: "Ontobiotope term for the isolation habitat",
+        FIELD: "ontobiotopeTerms",
         VALIDATION: [
             {TYPE: CROSSREF, CROSSREF_NAME: "Ontobiotope",
              MULTIPLE: True, SEPARATOR: ";", ERROR_CODE: "STD41"}
         ]
+    },
+      {
+        FIELD: "qps",
+         VALIDATION: [
+            {TYPE: CHOICES, VALUES: ["1", "2"],
+             ERROR_CODE: "STD49"}
+        ]
     },
     {
-        FIELD: "GMO",
+        FIELD: "gmo",
         VALIDATION: [
             {TYPE: CHOICES, VALUES: ["1", "2"],
              ERROR_CODE: "STD42"}
         ]
     },
     {
-        FIELD: "GMO construction information",
+        FIELD: "gmoConstruction",
+        VALIDATION: []
     },
     {
-        FIELD: "Mutant information",
+        FIELD: "mutant",
+        VALIDATION: []
     },
     {
-        FIELD: "Genotype",
+        FIELD: "genotype",
+        VALIDATION: []
     },
     {
-        FIELD: "Sexual state",
+        FIELD: "Plant pathogenicity code",
+        VALIDATION: []
+    },
+    {
+        FIELD: "sexualState",
         VALIDATION: [
             {TYPE: CROSSREF, CROSSREF_NAME: SEXUAL_STATE_SHEET,
              ERROR_CODE: "STD43"}
@@ -258,46 +310,78 @@ STRAIN_FIELDS = [
         ]
     },
     {
-        FIELD: "Ploidy",
+        FIELD: "ploidy",
         VALIDATION: [
-            {TYPE: CHOICES, VALUES: ["0", "1", "2", "3", "4", "9"],
+            {TYPE: CHOICES, VALUES: ["1", "2", "3", "4", "5", "9"],
              ERROR_CODE: "STD44"}
         ]
     },
     {
-        FIELD: "Plasmids",
+        FIELD: "plasmids",
+        VALIDATION: []
     },
     {
-        FIELD: "Plasmids collections fields",
+        FIELD: "plasmidCollections",
+         VALIDATION: [
+            {TYPE: REGEXP, MATCH: "([a-zA-Z .'-]+)\(([a-zA-Z .'-]+) (\d+)\)(\s*;([a-zA-Z .'-]+)\(([a-zA-Z .'-]+) (\d+)\))*$",
+             ERROR_CODE: "STD62"}
+         ]
     },
     {
         # value can be in the cell or in another sheet. Don't configure this
-        FIELD: "Literature",
+        FIELD: "identificationLiterature",
         VALIDATION: [
             {TYPE: CROSSREF, CROSSREF_NAME: LITERATURE_SHEET,
              MULTIPLE: True, SEPARATOR: ";", ERROR_CODE: "STD45"}
         ]
     },
     {
-        FIELD: "Plant pathogenicity code",
+        FIELD: "pathogenicity",
+        VALIDATION: []
     },
     {
-        FIELD: "Pathogenicity",
+        FIELD: "enzymes",
+        VALIDATION: []
     },
     {
-        FIELD: "Enzyme production",
+        FIELD: "metabolites",
+        VALIDATION: []
     },
     {
-        FIELD: "Production of metabolites",
+        FIELD: "applications",
+        VALIDATION: []
     },
     {
-        FIELD: "Applications",
+        FIELD: "remarks",
+        VALIDATION: []
     },
     {
-        FIELD: "Remarks"
+        FIELD: "sequenceLiterature",
+        VALIDATION: [
+             {TYPE: REGEXP, MATCH: "^\d+(\s*;?\s*\d+)*$", ERROR_CODE: "STD61"},
+        ]
+
     },
-    {
-        FIELD: "Literature linked to the sequence/genome",
+
+ {
+        FIELD: "recommendedMedium",
+        VALIDATION: [
+            {TYPE: MANDATORY, ERROR_CODE: "STD33"},
+            {TYPE: MISSING, ERROR_CODE: "STD34"},
+            {TYPE: CROSSREF, CROSSREF_NAME: "Growth media",
+             MULTIPLE: True, SEPARATOR: "/", ERROR_CODE: "STD35"}
+        ]
+    },
+
+
+ {
+        FIELD: "country",
+        VALIDATION: [
+            {TYPE: MANDATORY, ERROR_CODE: "STD54"},
+            {TYPE: MISSING, ERROR_CODE: "STD55"},
+            {TYPE: ISO, ERROR_CODE: "STD57"},
+            #{TYPE: CROSSREF, CROSSREF_NAME: COUNTRY_CODES_SHEET, ERROR_CODE: "STD57"}
+        ]
     },
 ]
 SHEETS_SCHEMA = {
@@ -317,7 +401,7 @@ SHEETS_SCHEMA = {
                 FIELD: "Country",
                 VALIDATION: [
                     {TYPE: MANDATORY, ERROR_CODE: "GOD03"},
-                    {TYPE: MISSING, ERROR_CODE: "GOD04"}
+                    {TYPE: MISSING, ERROR_CODE: "GOD04"},
                 ]
             },
             {
@@ -389,6 +473,7 @@ SHEETS_SCHEMA = {
                 VALIDATION: [
                     {TYPE: MANDATORY, ERROR_CODE: "GID07"},
                     {TYPE: MISSING, ERROR_CODE: "GID08"},
+                    {TYPE: REGEXP, MATCH: "^[A-Z]{2}[0-9]{6}$", ERROR_CODE: "GID11"},
                 ]
             },
             {
@@ -399,11 +484,9 @@ SHEETS_SCHEMA = {
     },
     STRAINS: {
         "acronym": "STD",
-        'id_field': 'Accession number',
+        'id_field': 'accessionNumber',
         VALIDATION: {TYPE: MANDATORY, ERROR_CODE: "EFS05"},
-        ROW_VALIDATION: [
-            {TYPE: NAGOYA, ERROR_CODE: "STD46"},
-        ],
+        ROW_VALIDATION: [],
         COLUMNS: STRAIN_FIELDS,
     },
     LITERATURE_SHEET: {
@@ -421,6 +504,18 @@ SHEETS_SCHEMA = {
                     {TYPE: MISSING, ERROR_CODE: "LID02"},
                 ]
             },
+            {
+                FIELD: "PMID",
+                VALIDATION: [
+                    {TYPE: MANDATORY, ERROR_CODE: "LID18"},
+                ]
+            },
+            {
+                FIELD: "DOI",
+                VALIDATION: [
+                    {TYPE: MANDATORY, ERROR_CODE: "LID20"},
+                ]
+            },
             {
                 FIELD: "Full reference",
                 VALIDATION: [
@@ -465,7 +560,6 @@ SHEETS_SCHEMA = {
                 FIELD: "First page",
                 VALIDATION: [
                     {TYPE: MANDATORY, ERROR_CODE: "LID15"},
-                    {TYPE: MISSING, ERROR_CODE: "LID16"},
                 ]
             },
             {
@@ -504,13 +598,38 @@ SHEETS_SCHEMA = {
             },
             {
                 FIELD: "Name",
+                VALIDATION: []
+            },
+        ]
+    },
+    
+ 
+
+
+   
+    CONTROL_SHEET: {
+        "acronym": "VRS",
+        "id_field": "Version",
+        VALIDATION: {TYPE: MANDATORY, ERROR_CODE: "EFS09"},
+        COLUMNS:  [
+            {
+                FIELD: "Version",
                 VALIDATION: [
-                    {TYPE: MANDATORY, ERROR_CODE: "OTD03"},
-                    {TYPE: MISSING, ERROR_CODE: "OTD04"},
+                    {TYPE: MANDATORY, ERROR_CODE: "VRS01"},
+                    {TYPE: MISSING, ERROR_CODE: "VRS02"},
+                    {TYPE: VERSION, ERROR_CODE: "VRS05"},
+                ]
+            },
+            {
+                FIELD: "Date",
+                VALIDATION: [
+                     {TYPE: MANDATORY, ERROR_CODE: "VRS03"},
+                    {TYPE: MISSING, ERROR_CODE: "VRS04"},
                 ]
             },
         ]
     },   
+    
     MARKERS: {
          "acronym": "MKD",
          "id_field": "Acronym",
@@ -527,19 +646,28 @@ SHEETS_SCHEMA = {
      },  
 }
 
+
 CROSS_REF_CONF = {
-    ONTOBIOTOPE: ['ID', 'Name'],
-    LITERATURE_SHEET: ['ID'],
-    LOCATIONS: ['Locality'],
+    ONTOBIOTOPE: ['ID'],
+    LITERATURE_SHEET: ['ID', 'DOI',	'PMID',	'Full reference',	'Authors',	'Title',	'Journal',	'Year',	'Volume',	'First page'],
+    LOCATIONS: ['ID', 'Locality'],
     GROWTH_MEDIA: ['Acronym'],
-    STRAINS: ["Accession number"],
+    STRAINS: ["accessionNumber"],
     SEXUAL_STATE_SHEET: [],
     MARKERS: ["Acronym"],
+    
 }
 
-MIRRI_20200601_VALLIDATION_CONF = {
+MIRRI_12052023_VALLIDATION_CONF = {
     'sheet_schema': SHEETS_SCHEMA,
     'cross_ref_conf': CROSS_REF_CONF,
     'keep_sheets_in_memory': [
         {'sheet_name': LOCATIONS, 'indexed_by': 'Locality'}]
 }
+
+version_config = {
+    '5.1.2':  MIRRI_12052023_VALLIDATION_CONF,
+     'date': '12/05/2023'
+
+}
+